ID: 1055036425

View in Genome Browser
Species Human (GRCh38)
Location 9:71823166-71823188
Sequence CAGAATAATTAGATGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055036425_1055036430 -5 Left 1055036425 9:71823166-71823188 CCTGGCCCCATCTAATTATTCTG No data
Right 1055036430 9:71823184-71823206 TTCTGAGTTCTGCTACCTGAGGG No data
1055036425_1055036429 -6 Left 1055036425 9:71823166-71823188 CCTGGCCCCATCTAATTATTCTG No data
Right 1055036429 9:71823183-71823205 ATTCTGAGTTCTGCTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055036425 Original CRISPR CAGAATAATTAGATGGGGCC AGG (reversed) Intergenic
No off target data available for this crispr