ID: 1055036429

View in Genome Browser
Species Human (GRCh38)
Location 9:71823183-71823205
Sequence ATTCTGAGTTCTGCTACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055036424_1055036429 -3 Left 1055036424 9:71823163-71823185 CCACCTGGCCCCATCTAATTATT No data
Right 1055036429 9:71823183-71823205 ATTCTGAGTTCTGCTACCTGAGG No data
1055036421_1055036429 28 Left 1055036421 9:71823132-71823154 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1055036429 9:71823183-71823205 ATTCTGAGTTCTGCTACCTGAGG No data
1055036425_1055036429 -6 Left 1055036425 9:71823166-71823188 CCTGGCCCCATCTAATTATTCTG No data
Right 1055036429 9:71823183-71823205 ATTCTGAGTTCTGCTACCTGAGG No data
1055036422_1055036429 27 Left 1055036422 9:71823133-71823155 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1055036429 9:71823183-71823205 ATTCTGAGTTCTGCTACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055036429 Original CRISPR ATTCTGAGTTCTGCTACCTG AGG Intergenic
No off target data available for this crispr