ID: 1055036430

View in Genome Browser
Species Human (GRCh38)
Location 9:71823184-71823206
Sequence TTCTGAGTTCTGCTACCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055036426_1055036430 -10 Left 1055036426 9:71823171-71823193 CCCCATCTAATTATTCTGAGTTC No data
Right 1055036430 9:71823184-71823206 TTCTGAGTTCTGCTACCTGAGGG No data
1055036422_1055036430 28 Left 1055036422 9:71823133-71823155 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1055036430 9:71823184-71823206 TTCTGAGTTCTGCTACCTGAGGG No data
1055036424_1055036430 -2 Left 1055036424 9:71823163-71823185 CCACCTGGCCCCATCTAATTATT No data
Right 1055036430 9:71823184-71823206 TTCTGAGTTCTGCTACCTGAGGG No data
1055036421_1055036430 29 Left 1055036421 9:71823132-71823154 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1055036430 9:71823184-71823206 TTCTGAGTTCTGCTACCTGAGGG No data
1055036425_1055036430 -5 Left 1055036425 9:71823166-71823188 CCTGGCCCCATCTAATTATTCTG No data
Right 1055036430 9:71823184-71823206 TTCTGAGTTCTGCTACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055036430 Original CRISPR TTCTGAGTTCTGCTACCTGA GGG Intergenic
No off target data available for this crispr