ID: 1055037089

View in Genome Browser
Species Human (GRCh38)
Location 9:71829293-71829315
Sequence GAGATTTACAACCAAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055037086_1055037089 -7 Left 1055037086 9:71829277-71829299 CCAACAAGGACCAGTAGAGATTT No data
Right 1055037089 9:71829293-71829315 GAGATTTACAACCAAGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055037089 Original CRISPR GAGATTTACAACCAAGGAGT AGG Intergenic
No off target data available for this crispr