ID: 1055053379

View in Genome Browser
Species Human (GRCh38)
Location 9:72001290-72001312
Sequence AAGGGGATGCAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055053366_1055053379 11 Left 1055053366 9:72001256-72001278 CCACGTATTGGGTTAAGGGGTGG No data
Right 1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055053379 Original CRISPR AAGGGGATGCAGAAGGAGGA TGG Intergenic
No off target data available for this crispr