ID: 1055062282

View in Genome Browser
Species Human (GRCh38)
Location 9:72082263-72082285
Sequence GGCAGAACTGACTTCTTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055062280_1055062282 -10 Left 1055062280 9:72082250-72082272 CCATTCTTTTTCTGGCAGAACTG No data
Right 1055062282 9:72082263-72082285 GGCAGAACTGACTTCTTTGCGGG No data
1055062278_1055062282 15 Left 1055062278 9:72082225-72082247 CCTGATGTCAGCTGGGGAAGAAG No data
Right 1055062282 9:72082263-72082285 GGCAGAACTGACTTCTTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055062282 Original CRISPR GGCAGAACTGACTTCTTTGC GGG Intergenic
No off target data available for this crispr