ID: 1055062293

View in Genome Browser
Species Human (GRCh38)
Location 9:72082337-72082359
Sequence TGCCAGAGCCATAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055062293_1055062299 11 Left 1055062293 9:72082337-72082359 CCCTGCTCCTTATGGCTCTGGCA No data
Right 1055062299 9:72082371-72082393 CCCTAGAGGGACCCCTTACAAGG No data
1055062293_1055062296 -3 Left 1055062293 9:72082337-72082359 CCCTGCTCCTTATGGCTCTGGCA No data
Right 1055062296 9:72082357-72082379 GCATGCAATGCACTCCCTAGAGG No data
1055062293_1055062297 -2 Left 1055062293 9:72082337-72082359 CCCTGCTCCTTATGGCTCTGGCA No data
Right 1055062297 9:72082358-72082380 CATGCAATGCACTCCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055062293 Original CRISPR TGCCAGAGCCATAAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr