ID: 1055066933

View in Genome Browser
Species Human (GRCh38)
Location 9:72128691-72128713
Sequence GTCTCACAGGACTACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055066933_1055066939 10 Left 1055066933 9:72128691-72128713 CCATCACAGTAGTCCTGTGAGAC 0: 1
1: 1
2: 4
3: 29
4: 254
Right 1055066939 9:72128724-72128746 CCAGCATCTTTATATAAGCAGGG No data
1055066933_1055066937 9 Left 1055066933 9:72128691-72128713 CCATCACAGTAGTCCTGTGAGAC 0: 1
1: 1
2: 4
3: 29
4: 254
Right 1055066937 9:72128723-72128745 GCCAGCATCTTTATATAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055066933 Original CRISPR GTCTCACAGGACTACTGTGA TGG (reversed) Intronic
900358844 1:2278318-2278340 GTCTCACAGCAGGACAGTGAAGG - Intronic
901344766 1:8530133-8530155 GGATCACAGGACTTCTGGGAAGG - Intronic
903641168 1:24861530-24861552 GTCTCACATGGCTATTGTTAGGG + Intergenic
903885371 1:26537855-26537877 GTCTCACAGGAGCAATGTGAAGG + Intronic
905338723 1:37263748-37263770 GTCTCACAGGACTGCAGTCAAGG - Intergenic
905458812 1:38107329-38107351 GTCTCACAGGACTGTGGTGAAGG + Intergenic
905849177 1:41260202-41260224 GTCTCACAAGACTTCAGTCAAGG - Intergenic
908406387 1:63818029-63818051 ATCTCACAGGGTTACTGTAAAGG - Intronic
909608506 1:77530673-77530695 GACTCACAGGACTATTGTGAGGG - Intronic
911022744 1:93405562-93405584 GTCTCCCAGTACTATTGTGTGGG + Intergenic
911443709 1:97963792-97963814 TTCTCACAGTTCTACTCTGAAGG - Intergenic
911478816 1:98410300-98410322 GTCTCACAGGGCTTTTGTGAGGG - Intergenic
912465662 1:109871703-109871725 GTCTCACAGGACTAAGATCAAGG - Intergenic
916182925 1:162103539-162103561 GTCTCCCACGACTACTCTGTGGG + Intronic
916330287 1:163608477-163608499 TTCTCACATGAATCCTGTGAGGG + Intergenic
917835025 1:178934713-178934735 ATCTCATAGGACTGGTGTGAGGG - Intergenic
918644933 1:186892800-186892822 CTCTCACAGGACTATTATGAAGG + Intronic
920429906 1:205911850-205911872 TTCTCACAGGGCTCCTGGGAAGG + Intergenic
920514870 1:206577455-206577477 GTCTCACAGGATTGATGTGAAGG - Intronic
920850567 1:209625491-209625513 GCCTCACAGGACTGTTGTAATGG + Intronic
921469838 1:215534742-215534764 GTCTCCCATGATTACTGTGTGGG - Intergenic
924118758 1:240774666-240774688 ATCTTATAGGACTGCTGTGATGG + Intergenic
924204805 1:241700749-241700771 ATCTCACAGGATTTTTGTGATGG + Intronic
1063772747 10:9222600-9222622 GTATCACAGGACTACAATTAAGG - Intergenic
1064616994 10:17169064-17169086 TTCTCAAAGCAATACTGTGAAGG + Intronic
1066709584 10:38218790-38218812 GTCTCCCATTACTACTGTGTGGG - Intergenic
1068869682 10:61929596-61929618 GGCTCACAGGGCTAGTGTGGTGG + Intronic
1068929751 10:62577215-62577237 ACCTCACTGGACTATTGTGAAGG + Intronic
1069424098 10:68274582-68274604 TTCTCACAAGGCTACTGTCAAGG + Intergenic
1072890479 10:99319278-99319300 GTCTCATAGGGTTACTGTGAGGG + Intergenic
1073238628 10:102038645-102038667 TTCTGACAGGAATTCTGTGAGGG - Intronic
1074153160 10:110776415-110776437 GCCTCACTGGACTACGGTCAAGG + Intronic
1074183738 10:111083935-111083957 GACTCTCAGGCCCACTGTGAGGG - Intergenic
1075884422 10:125885628-125885650 GTCTCACTGGACTACAATCAAGG - Intronic
1080006113 11:27408861-27408883 TTCTCACAGAACTACCGTAAAGG - Intronic
1080330742 11:31134393-31134415 GAGTCACAGGACTCCTCTGATGG + Intronic
1080340736 11:31260670-31260692 GTCTGTTAGGACTTCTGTGAAGG - Intronic
1080700383 11:34639465-34639487 GCCTCACAGGACTGTTGAGATGG - Intronic
1082641112 11:55662777-55662799 GGCTCACAAAACTGCTGTGAAGG - Intergenic
1082681877 11:56183855-56183877 AGCTCACAGAACTATTGTGATGG + Intergenic
1083608126 11:63991214-63991236 GCCTCACAGGGCAATTGTGAGGG + Intronic
1084266341 11:68007286-68007308 GCCTCACATGGCTACTGCGAGGG - Intergenic
1085134918 11:74077998-74078020 ATCTCACAGGATTGCTGGGAGGG + Intronic
1085323866 11:75592021-75592043 TTCCCCCAGGACTGCTGTGAGGG - Intronic
1085780125 11:79400673-79400695 GTGTCACAGAGCTGCTGTGAGGG + Intronic
1085951680 11:81340077-81340099 GTCACACAGGAATATAGTGATGG - Intergenic
1085955683 11:81391160-81391182 AACTCACAGGACTATTGTAAAGG + Intergenic
1086872341 11:92053688-92053710 GACTCACAGAGCTCCTGTGAGGG + Intergenic
1087766019 11:102154879-102154901 GGCTCACATGTCTGCTGTGAGGG - Intronic
1087766094 11:102155829-102155851 GGCTCATACGACTACAGTGAGGG - Intronic
1088352745 11:108908854-108908876 GTTTCACAGGACGACTGTGCAGG - Intronic
1089085229 11:115811478-115811500 GTGTCCAAGGACCACTGTGATGG - Intergenic
1089705422 11:120274299-120274321 GTCTCACGGGGTTATTGTGAGGG + Intronic
1090006505 11:123007447-123007469 ATCTCACAGTACTGTTGTGAAGG + Intergenic
1090619410 11:128548352-128548374 ACCTCACAGAATTACTGTGAAGG - Intronic
1091460312 12:639327-639349 GTCTTATAAGACTATTGTGAGGG - Intronic
1092367386 12:7888271-7888293 GTGTCACAGGACTGCTGGGGTGG - Intronic
1095968371 12:47884319-47884341 GCCTCACAGAACTGTTGTGAGGG - Intronic
1096544615 12:52329005-52329027 GTCTCAGAGGACAACTGAGATGG - Intergenic
1097496215 12:60339390-60339412 ATCTCACAGAACTACAGTTAAGG + Intergenic
1097913610 12:64996540-64996562 GTCTCAAAGGACTAATATGAGGG + Intergenic
1098298639 12:69030214-69030236 GTCTCACAGGGGTATTTTGATGG + Intergenic
1099054941 12:77827766-77827788 TTCTCACAGCACCCCTGTGAAGG + Intergenic
1099135943 12:78901751-78901773 TGATCACATGACTACTGTGAAGG - Intronic
1099541067 12:83908217-83908239 GTCTCTTAGGACTGCTGTAAAGG + Intergenic
1102402104 12:112638718-112638740 CTCTCACAGGACCACTGTTTTGG + Intronic
1102627595 12:114247932-114247954 GGCTCATAGGGCTACTGAGAGGG - Intergenic
1102815738 12:115864571-115864593 GTCTCACTGAATTACTCTGATGG + Intergenic
1102837156 12:116075330-116075352 ATCTCACAAGGCTACTGTGGGGG + Intronic
1106594495 13:31124918-31124940 GTCTCACAGGATTGTTGGGAGGG - Intergenic
1107483081 13:40801417-40801439 TTCTCACAGGATCACGGTGAGGG - Intronic
1108113731 13:47105038-47105060 GTCTCCCAGTACTATTGTGTGGG - Intergenic
1108593166 13:51928412-51928434 GTCTCACAGCACTGCCATGAGGG - Intergenic
1108705074 13:52977939-52977961 GTCTCAGAGGGCTGCAGTGAGGG + Intergenic
1109108737 13:58289429-58289451 GTCTCACAGGACTAATATGAAGG + Intergenic
1110291426 13:73811625-73811647 ATCTGACAGGACTATTGAGAAGG - Intronic
1113358151 13:109602654-109602676 GTCTAACAGGAGTACTTTTATGG - Intergenic
1114083102 14:19218625-19218647 GTCTCACAGGGTTGTTGTGAGGG - Intergenic
1115827717 14:37295838-37295860 GTCTCCCATGATTACTGTGTGGG - Intronic
1115832809 14:37361435-37361457 GTCTCCCATTACTACTGTGTGGG + Intronic
1119207386 14:72804766-72804788 GTTTCACAGGAGTAGTGAGAAGG - Intronic
1122232432 14:100313452-100313474 GTTTCCCAGGGCTACTGTGCAGG + Intergenic
1202894723 14_GL000194v1_random:393-415 GTCTCACAGGGTTGTTGTGAGGG - Intergenic
1126653482 15:50951169-50951191 GTCTCACAGGGTTGCAGTGAAGG + Intronic
1128585249 15:68843796-68843818 GTCTTACAGGCCAACTGTGCCGG - Intronic
1128790323 15:70428502-70428524 GTCTCACAGGGCTAATATCAAGG - Intergenic
1129161167 15:73748726-73748748 ATCTCACAGGAAGACGGTGATGG + Intronic
1132344420 15:101099703-101099725 ATCTCACAGGACTACTGTGAAGG + Intergenic
1133030562 16:3008851-3008873 GCCGCACAGGGCCACTGTGAAGG + Intergenic
1133208209 16:4246826-4246848 GCCTCATAGAACTGCTGTGAGGG + Intergenic
1133739689 16:8641737-8641759 TCCTCACAGGACTATTGGGAGGG - Intronic
1134285798 16:12861068-12861090 GTCTCCCAGGACTGCTAAGATGG + Intergenic
1134316702 16:13125487-13125509 ATCTCACAGAACCATTGTGATGG + Intronic
1135758032 16:25114271-25114293 GTCTCAGAGGATTGCTGTGCAGG + Intronic
1137952794 16:52799601-52799623 GTGTCACATGAATACTGTGATGG + Intergenic
1138658191 16:58502517-58502539 GTCTCAGAGGACCACTGTCCAGG - Intronic
1139748272 16:69092071-69092093 ATCTCACAGGCCCAGTGTGAGGG - Intergenic
1140486071 16:75294557-75294579 ACCTCACAGGACTGCAGTGAAGG + Intronic
1140830468 16:78745984-78746006 GTCTCAGAAGGCTACTGGGAAGG + Intronic
1141446204 16:84060264-84060286 TTTTCACAGGATTACTGAGAGGG + Intronic
1142080707 16:88147300-88147322 GTCTCCCTGGGCTACGGTGAGGG - Intergenic
1143783787 17:9242489-9242511 GTCTCACGGGTGTCCTGTGAGGG + Exonic
1144555890 17:16282570-16282592 GGCTAACAGGACTACTTAGATGG + Intronic
1144904174 17:18626416-18626438 ACCTCACAGGACCTCTGTGAGGG + Intergenic
1145879602 17:28343689-28343711 GTCTCACAGGCATGTTGTGAGGG - Intronic
1150248506 17:63693168-63693190 GTCTCACAGGGCTAAAGTCAAGG - Intronic
1151356316 17:73560776-73560798 TGCTTACAGGGCTACTGTGAGGG + Intronic
1151968754 17:77446195-77446217 GTCTCACCGGACTAAAGTCAAGG + Intronic
1153973170 18:10244952-10244974 GTCTCACAGGCCTGCTGTGAAGG - Intergenic
1154499803 18:14990300-14990322 GTCTCACAGGGTTGTTGTGAGGG - Intergenic
1155601163 18:27549625-27549647 GTCTCACTGGACTACAATCAAGG - Intergenic
1157157036 18:45278534-45278556 ATATCACAGGATCACTGTGATGG + Intronic
1157342439 18:46791400-46791422 ACCTCACAGGACCACTATGATGG + Intergenic
1158584016 18:58713717-58713739 GGTTTACAGAACTACTGTGAAGG - Intronic
1159037371 18:63290579-63290601 GTCACACAGGATTACTGTGATGG - Intronic
1162569581 19:11463457-11463479 GTCTCAGAGAATTACAGTGAAGG + Intronic
1162971128 19:14182167-14182189 ATCTCACAGGACTGTTGTGATGG + Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1163840577 19:19606457-19606479 GTCTCACAGGGCTGCAGTCAAGG - Intronic
1166849183 19:45750183-45750205 GTCTCACTGGTCTGCAGTGAGGG - Intronic
1168554219 19:57324389-57324411 GTTTCATAGGGCTAGTGTGAGGG + Intronic
925155145 2:1643367-1643389 GTGTGGCAGGACTGCTGTGAAGG - Exonic
925227652 2:2199578-2199600 GGCTCACAGGACTTGAGTGAGGG + Intronic
926059821 2:9798260-9798282 CTCTCACAGGACTGCTGGGCAGG - Intergenic
926754833 2:16226505-16226527 GCCTGACAGGACCTCTGTGAGGG + Intergenic
926837202 2:17036201-17036223 CTCTCACAGAACTACTGTATGGG - Intergenic
928600029 2:32895470-32895492 GTCTCACTGGACTGCAGTCAAGG - Intergenic
929222403 2:39478013-39478035 ATCTCACATGACTAGAGTGACGG - Intergenic
929700135 2:44155342-44155364 TTCTTAGAGGACTATTGTGAAGG + Intergenic
930236799 2:48896276-48896298 GTCTCATAGGGCTGATGTGAAGG + Intergenic
930581235 2:53215062-53215084 GTCTCCCACTACTACTGTGTGGG + Intergenic
932007954 2:67946482-67946504 ATGTCACAGAACCACTGTGAAGG + Intergenic
932300254 2:70661964-70661986 CCCTCAAAGGATTACTGTGAGGG + Exonic
932936625 2:76110575-76110597 GTCCCACAAGACTACAGTCAAGG + Intergenic
933655643 2:84884809-84884831 GTCTCACAAGGCTACAGTCAGGG - Intronic
935599706 2:104910532-104910554 ACCTCACAGGACTAATGTGAGGG + Intergenic
935708635 2:105877910-105877932 TTGTCACAGGACTGTTGTGAGGG + Intronic
937327556 2:121000464-121000486 GGGACACAGGACCACTGTGATGG - Intergenic
938493478 2:131778010-131778032 GTCTCACAGGGTTGTTGTGAGGG + Intergenic
938499011 2:131820655-131820677 GTCTCACAGGGTTGTTGTGAGGG - Intergenic
938510565 2:131937844-131937866 GGCTTACAGGAAAACTGTGAGGG - Intergenic
939488550 2:142848431-142848453 GTCTCCCAGGAACCCTGTGAGGG + Intergenic
940080343 2:149794217-149794239 GTCTCCCAGTATTACTGTGTGGG + Intergenic
941609232 2:167640293-167640315 GGCTCTGAGGACTACTGTTAAGG - Intergenic
941658284 2:168167865-168167887 GTTTCTCAGGACTGCTGTGATGG + Intronic
942728913 2:179041949-179041971 GTCTCCCACGACTATTGTGTGGG - Intronic
942862279 2:180629307-180629329 TTTTCACAGAAGTACTGTGATGG - Intergenic
944522703 2:200587665-200587687 CCTTCACAGGACTGCTGTGAGGG + Intronic
944848171 2:203689920-203689942 ATCTCACAGAACTACTGTATAGG - Intergenic
946032204 2:216714239-216714261 CTCTCCCAGGACTGCTGTGGAGG + Intergenic
946465864 2:219911556-219911578 GTCTCATAGGATTTCTGTGTAGG + Intergenic
947094311 2:226548856-226548878 GTCTCACTGGACTAAAATGAAGG + Intergenic
1169344396 20:4818887-4818909 ATCTCACAGCAATATTGTGAGGG - Intronic
1170343528 20:15356257-15356279 TTCTCTCAGCAATACTGTGAAGG - Intronic
1173565222 20:44033751-44033773 GTCTCACTGAACTAAAGTGAAGG - Intronic
1176012745 20:62908368-62908390 GTCTCACAGGACTGCAGTCACGG - Intronic
1176614422 21:9016380-9016402 GTCTCACAGGGTTGTTGTGAGGG - Intergenic
1176710778 21:10147490-10147512 GTCTCACAGGGTTGTTGTGAGGG + Intergenic
1177523922 21:22268156-22268178 GTCTCACAGGACTAAAATAAAGG - Intergenic
1178461314 21:32805260-32805282 GTCTGACCAGGCTACTGTGAGGG - Intronic
1179476571 21:41650315-41650337 CACTCACAGGGCTACTGGGAGGG + Intergenic
1180077749 21:45471819-45471841 AGCTCACAGGAATTCTGTGAGGG - Intronic
1180497677 22:15904056-15904078 GTCTCACAGGGTTGTTGTGAGGG + Intergenic
1180594417 22:16963971-16963993 GGCTCACAGGACTGCTGAAAGGG - Intronic
1182877362 22:33703765-33703787 GTCTCACTGGACTAAAGTCAGGG - Intronic
1182877725 22:33706873-33706895 GTCTCACTGGACTAAAGTCAGGG - Intronic
1183136512 22:35894324-35894346 ATTTCACAAGACTATTGTGAAGG + Intronic
949761036 3:7471295-7471317 GTCTCACAGGACTAATATCAAGG + Intronic
950692824 3:14673896-14673918 GTGTCACAGTAAGACTGTGATGG - Intergenic
951359844 3:21712269-21712291 GTCTCAGATTCCTACTGTGATGG - Intronic
951619435 3:24584905-24584927 CTCTCACAGGATTTGTGTGAAGG + Intergenic
951656132 3:25010640-25010662 CTCTCACAGGGGTACTGTGGGGG - Intergenic
951997814 3:28750753-28750775 GTCTCCCACTACTACTGTGTGGG - Intergenic
955950973 3:64241742-64241764 CTCTCACAGCATTCCTGTGAAGG - Intronic
959002995 3:100986320-100986342 GTCTCACAAGGCAACAGTGAAGG - Intronic
959003722 3:100995158-100995180 GTCTCACTGGCTTAATGTGATGG - Intergenic
959680627 3:109091640-109091662 CTCTGACACGAGTACTGTGATGG - Intronic
962021654 3:131508501-131508523 GTCTCACTGGGCTACTATGAAGG - Intergenic
962641766 3:137394538-137394560 GTCTCCCAGTATTATTGTGAGGG + Intergenic
963477585 3:145826741-145826763 GTCTCCCAGTACTATTGTGTGGG + Intergenic
964495987 3:157290334-157290356 GTCTCACAGGGCTACAGTCAAGG - Intronic
964513283 3:157477129-157477151 GTCTCACTGGACTAAAGTCAAGG + Intronic
965543531 3:169893053-169893075 GCCTCACAGGTCTGTTGTGATGG + Intergenic
965721788 3:171669800-171669822 GTCTCACAGGATTGTGGTGATGG - Intronic
969236977 4:5872324-5872346 CTCTCACGGGGTTACTGTGAGGG + Intronic
969518032 4:7659473-7659495 GGCTCACAGGGGTTCTGTGAGGG - Intronic
969663752 4:8545242-8545264 GTCTCCCAGGACTACAGCAACGG + Intergenic
969964034 4:10975776-10975798 TTCTCACAGCAACACTGTGAGGG - Intergenic
970980022 4:22085524-22085546 TTGTCAATGGACTACTGTGATGG - Intergenic
971869618 4:32217610-32217632 TACTCATAGGACTGCTGTGAGGG + Intergenic
972168618 4:36318069-36318091 GTATCATAGGATTTCTGTGAGGG - Intronic
972611193 4:40657119-40657141 GTCTCAGAGAACTACTCTGAAGG + Intergenic
972693604 4:41423119-41423141 TTCTGAGGGGACTACTGTGAAGG + Intronic
972921697 4:43950416-43950438 GTCTCACTGGTCTAAAGTGAAGG - Intergenic
974847580 4:67369422-67369444 ATCTCATAGGACTAATCTGAGGG - Intergenic
975583807 4:75930458-75930480 GCCTAACAGGACTGTTGTGAGGG + Intronic
975950577 4:79765224-79765246 ATCTCATAGGACTAATCTGAGGG + Intergenic
978859651 4:113432878-113432900 GTCTCACAGGGCTAGAATGAAGG - Intergenic
979459684 4:120967809-120967831 TTCTCATAGGGCTACTATGAAGG - Intergenic
979790075 4:124768705-124768727 GTTTCACAGAATTATTGTGAAGG - Intergenic
980091329 4:128445995-128446017 GTCTCACAGGGTTCTTGTGAGGG + Intergenic
980112601 4:128649060-128649082 TTCTCACAGCACATCTGTGAGGG + Intergenic
981388755 4:144162680-144162702 GTCTCCCATTACTATTGTGAGGG + Intergenic
982382398 4:154763132-154763154 ACCTCTCAGGATTACTGTGAAGG + Intergenic
982590228 4:157299920-157299942 GTCTCACAGTGTTATTGTGAAGG + Intronic
984975759 4:185228834-185228856 TTCTCATAGGATAACTGTGAAGG - Intronic
985488464 5:165175-165197 GGCTCACAGTACTCCTCTGACGG + Intronic
987117893 5:14740602-14740624 GTGTCAGAGGTCTTCTGTGATGG + Intronic
987292393 5:16521101-16521123 GACCCACAGGACTTCTGAGAGGG - Intronic
987385492 5:17325170-17325192 GTCTCACTGGGCTAAAGTGAAGG - Intergenic
988912769 5:35861464-35861486 GCCTCACAGGAAGGCTGTGATGG + Intronic
989200862 5:38762026-38762048 ATCTCACAGGGTTATTGTGAGGG - Intergenic
991298445 5:65104597-65104619 GTCTCACAGGGATGCTTTGAAGG + Intergenic
991529702 5:67601934-67601956 GTCTCCCATGATTACTGTGTTGG + Intergenic
991532397 5:67630364-67630386 GTCTCCCATGATTACTGTGTTGG + Intergenic
991609792 5:68438157-68438179 ATCTCGCAGGATTATTGTGAAGG + Intergenic
992450333 5:76870501-76870523 GTCTCACAGAACCCCTCTGAAGG + Intronic
992466047 5:77005973-77005995 GTCTCACTGGACTACAGTCAAGG - Intergenic
992491094 5:77245674-77245696 ATCTCACGGGGCTGCTGTGAGGG - Intronic
992654844 5:78898670-78898692 GTCTCACTGGGCTAATGTCAAGG + Intronic
999399937 5:151256969-151256991 TTCTCACAGGGCTATTGTGAGGG - Intronic
1000176802 5:158764068-158764090 ATATCACAGGACTGCTGTGAGGG - Intronic
1003072785 6:2957991-2958013 GCCTCCCACGCCTACTGTGATGG + Intronic
1003394871 6:5744414-5744436 ATCTCAGAGGACTGCTGTAATGG - Intronic
1006903515 6:37517924-37517946 GCCTCATAGGACTGATGTGAGGG + Intergenic
1007133233 6:39496441-39496463 GACTCACAGTACCCCTGTGAGGG + Intronic
1008526365 6:52411357-52411379 ACCTCACAGGGCTACTATGAGGG - Intergenic
1009570435 6:65376908-65376930 GTCTCCCACTATTACTGTGAGGG - Intronic
1012452007 6:99362586-99362608 GTCTCACATAAGTACTGTGTGGG - Intergenic
1012593437 6:101011482-101011504 GTCTCACTGGACTAAAATGAAGG - Intergenic
1013825562 6:114206634-114206656 AGCTCACAGCAATACTGTGAGGG + Intronic
1014313460 6:119833692-119833714 GGCACACAGGAATACTGTTATGG + Intergenic
1019509714 7:1411828-1411850 GCCTCACAGGGCTGTTGTGAGGG - Intergenic
1019776332 7:2913867-2913889 GTCTCCCAGGAGCACTGGGAGGG + Intronic
1019893664 7:3966355-3966377 GTCTCTCAAGTCTTCTGTGAGGG - Intronic
1019895475 7:3979203-3979225 ATCTCAAAGGACGGCTGTGAGGG + Intronic
1021168711 7:17372215-17372237 GTCTCCCTGGGCTACTGTCAAGG + Intergenic
1023146983 7:37161026-37161048 CTCTCACTGGCCTGCTGTGAGGG + Intronic
1023535374 7:41203261-41203283 TTCTTACAGGGTTACTGTGAGGG - Intergenic
1023656104 7:42422452-42422474 ACCTCACAGGATTACTGTGAAGG - Intergenic
1023694339 7:42829340-42829362 GTCTTACAGCATCACTGTGAAGG - Intergenic
1023892134 7:44400516-44400538 GCCTCACAGCAGTGCTGTGATGG + Intronic
1024530827 7:50391345-50391367 GTCTCAGAGGGCTGCTGTTAGGG + Intronic
1030570998 7:111224151-111224173 ATCTCACAGGACTGGTGTGATGG + Intronic
1033174670 7:139113166-139113188 ATCCCACTGGACTACTGTGATGG - Intergenic
1034075015 7:148222958-148222980 GTTTCACAACACTCCTGTGAGGG - Intronic
1037284304 8:17281365-17281387 GTCTCACAGATTTTCTGTGAAGG - Intronic
1039926477 8:41937945-41937967 GTCTTATAGCACTACTGTGAAGG + Intronic
1040391736 8:46955811-46955833 GTCTCAGGGGACACCTGTGACGG - Intergenic
1041113768 8:54513478-54513500 GTCTCACTGGACTAAAGTTAAGG - Intergenic
1042163382 8:65920987-65921009 GGCTCTCAGGACTACAGAGAGGG + Intergenic
1043429364 8:80179799-80179821 GCCTCACAGGACTAATGTCAAGG - Intronic
1043830703 8:84985338-84985360 GTTTCACTGGACTACAGTCAAGG + Intergenic
1045383388 8:101648521-101648543 GCCTCGCAGAGCTACTGTGAGGG - Intronic
1046783235 8:118238176-118238198 CACTCACAGGACCACTGAGAGGG + Intronic
1047693253 8:127377907-127377929 CCCTCACAGGGCTATTGTGAGGG + Intergenic
1047842516 8:128768175-128768197 GTCTGACTGGATTAATGTGAAGG - Intergenic
1048299598 8:133241585-133241607 ATGTCAAAGGAGTACTGTGATGG + Intronic
1048316495 8:133366890-133366912 GTCTCCCAGGCCTGCTGGGAGGG - Intergenic
1048781247 8:138004509-138004531 GTCTCACAGGATTATTATAAGGG - Intergenic
1049454935 8:142681977-142681999 GACTCACAGGACTACTACGTGGG + Exonic
1049785586 8:144449216-144449238 GACTCCCAGGGCTACTGGGAAGG - Intergenic
1050743505 9:8849740-8849762 GTATCACAGGGCTATGGTGAGGG + Intronic
1052055665 9:23904499-23904521 GTCTCAAAAGAATACTTTGATGG + Intergenic
1052098290 9:24410972-24410994 GTCTCCCAGTAGTACTGTGTGGG - Intergenic
1053647761 9:40133186-40133208 GTCTCACAGGGTTGTTGTGAGGG + Intergenic
1054328737 9:63731137-63731159 GTCTCACAGGGTTGTTGTGAGGG + Intergenic
1054536819 9:66242984-66243006 GTCTCACAGGGTTGTTGTGAGGG - Intergenic
1054881799 9:70151734-70151756 TTCTCACAGTACTCCTGTGAGGG + Intronic
1055066933 9:72128691-72128713 GTCTCACAGGACTACTGTGATGG - Intronic
1055499660 9:76890206-76890228 GTCTCAGAGGATGACGGTGAAGG + Intronic
1055839188 9:80482246-80482268 GTCTCAGAGTACAGCTGTGAGGG + Intergenic
1061218683 9:129236524-129236546 GCCTCACAGGGCAACTGGGAGGG - Intergenic
1202795538 9_KI270719v1_random:116478-116500 GTCTCACAGGGTTGTTGTGAGGG + Intergenic
1186144452 X:6610982-6611004 GTCTCACAAGACTGCAGGGAAGG - Intergenic
1186965706 X:14784276-14784298 GTCTCACTGGGCTACAGTCAAGG + Intergenic
1187679369 X:21751463-21751485 ATCTCATAGGATTACTATGAAGG - Intronic
1187989888 X:24858959-24858981 ACCTCACAGGAATACTGTGAGGG - Intronic
1188270006 X:28127679-28127701 GTCTCACTGGACTAAAGTCAAGG + Intergenic
1191678236 X:63814466-63814488 GTCTCACTGGATTGTTGTGAGGG - Intergenic
1192204239 X:69085715-69085737 GCCTGACAGGACAACTGCGAGGG - Intergenic
1194610863 X:96042239-96042261 GTCTCAAAGAACTAAAGTGACGG + Intergenic
1195688917 X:107608222-107608244 CTCTCAAAGGATTATTGTGAAGG - Intergenic
1196429544 X:115607987-115608009 AGCTCATAGGACTATTGTGAGGG + Intronic
1196562367 X:117165631-117165653 CTCTCCCAGGTTTACTGTGAAGG - Intergenic
1197615190 X:128682734-128682756 ATTTCACAGAAGTACTGTGAGGG + Intergenic
1198824806 X:140688315-140688337 CTCTCATAGGGTTACTGTGATGG + Intergenic
1198986347 X:142458461-142458483 CTCTCACAGGACTGCCTTGAAGG + Intergenic
1201408383 Y:13672733-13672755 CCCTCAAAGGACTCCTGTGAGGG - Intergenic