ID: 1055068219

View in Genome Browser
Species Human (GRCh38)
Location 9:72140311-72140333
Sequence TCTCCCTCCTCATGATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 254}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055068219_1055068222 12 Left 1055068219 9:72140311-72140333 CCTTGTGATCATGAGGAGGGAGA 0: 1
1: 0
2: 3
3: 30
4: 254
Right 1055068222 9:72140346-72140368 GAGTCTGTGTGGAAGAGAGAAGG No data
1055068219_1055068220 -10 Left 1055068219 9:72140311-72140333 CCTTGTGATCATGAGGAGGGAGA 0: 1
1: 0
2: 3
3: 30
4: 254
Right 1055068220 9:72140324-72140346 AGGAGGGAGACGTCAGAGAATGG No data
1055068219_1055068223 18 Left 1055068219 9:72140311-72140333 CCTTGTGATCATGAGGAGGGAGA 0: 1
1: 0
2: 3
3: 30
4: 254
Right 1055068223 9:72140352-72140374 GTGTGGAAGAGAGAAGGAGAAGG No data
1055068219_1055068221 1 Left 1055068219 9:72140311-72140333 CCTTGTGATCATGAGGAGGGAGA 0: 1
1: 0
2: 3
3: 30
4: 254
Right 1055068221 9:72140335-72140357 GTCAGAGAATGGAGTCTGTGTGG No data
1055068219_1055068224 19 Left 1055068219 9:72140311-72140333 CCTTGTGATCATGAGGAGGGAGA 0: 1
1: 0
2: 3
3: 30
4: 254
Right 1055068224 9:72140353-72140375 TGTGGAAGAGAGAAGGAGAAGGG No data
1055068219_1055068225 27 Left 1055068219 9:72140311-72140333 CCTTGTGATCATGAGGAGGGAGA 0: 1
1: 0
2: 3
3: 30
4: 254
Right 1055068225 9:72140361-72140383 AGAGAAGGAGAAGGGAAGAGCGG No data
1055068219_1055068226 28 Left 1055068219 9:72140311-72140333 CCTTGTGATCATGAGGAGGGAGA 0: 1
1: 0
2: 3
3: 30
4: 254
Right 1055068226 9:72140362-72140384 GAGAAGGAGAAGGGAAGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055068219 Original CRISPR TCTCCCTCCTCATGATCACA AGG (reversed) Intronic
900295387 1:1946666-1946688 TCCCCCTGCTCATGAGCTCATGG + Intronic
900814658 1:4834313-4834335 TATCTGTCCTCATCATCACATGG - Intergenic
900977547 1:6026757-6026779 TCTCCCTCAACATCATCCCAGGG - Intronic
901910149 1:12450617-12450639 GTTCCCTCTTCATGATCACGTGG - Intronic
902193124 1:14777675-14777697 TCTGCCTCCTCATTGTCACTCGG + Intronic
903288007 1:22289048-22289070 TCTTCCTGACCATGATCACATGG - Intergenic
904313537 1:29645110-29645132 TCTCCCTCCTGCTGTTCTCATGG - Intergenic
905488986 1:38328863-38328885 TCTGTCTCCTCATACTCACATGG + Intergenic
905603908 1:39279494-39279516 TCTCCCTTGTATTGATCACAAGG + Intronic
905773548 1:40653802-40653824 TGTCCCTGCTCATTCTCACAAGG - Intronic
906308038 1:44733479-44733501 TCTCCTGCCTCATGACCACAAGG + Intergenic
907194457 1:52675275-52675297 TCAGCCTCCACATGAGCACATGG - Intergenic
907519444 1:55013677-55013699 TCTCCCTCCACACTAGCACAGGG - Intergenic
907673121 1:56493968-56493990 TGGCCCTCTTCATGTTCACATGG - Intergenic
908038228 1:60079210-60079232 TCTCCGTCTTTATGTTCACATGG + Intergenic
908673484 1:66575107-66575129 TCTCCATAGTCCTGATCACATGG + Intronic
910602249 1:89044054-89044076 TCCCACTCCTCAAGAGCACAGGG + Intergenic
911089757 1:94009147-94009169 TTACCCTCCTCCTCATCACATGG - Intronic
912650853 1:111437791-111437813 TCTGGTACCTCATGATCACAGGG + Intergenic
913411862 1:118561161-118561183 TCTCAGTCCTCATGATGCCATGG + Intergenic
913533940 1:119753689-119753711 TCTCCCCTCTCATGAGGACAGGG + Intronic
913940019 1:125093531-125093553 TCTCTGTCCTCAAAATCACATGG + Intergenic
916584472 1:166138347-166138369 TCTTCATCCTCAATATCACAGGG + Intronic
917547109 1:175982447-175982469 TCTTCATCCTCATCTTCACATGG - Intronic
917648056 1:177048239-177048261 TCTCCCTCCTAATGGCAACATGG + Intronic
918112850 1:181472824-181472846 TCTCCCTCCCCATGAACAGCAGG - Intronic
918234866 1:182570689-182570711 GCTCCCACCTCATGAGGACAGGG + Intergenic
918413140 1:184281594-184281616 TCTCCTTCCTCACCATCACTGGG - Intergenic
919796829 1:201325872-201325894 TCTTCCTGCTCATGAGCAGAGGG + Intronic
922690812 1:227688432-227688454 ACTCTCTCCCCAGGATCACAAGG + Intergenic
923220473 1:231888367-231888389 TCTCCCTCCCCTTGCTCACTTGG - Intronic
923918469 1:238536276-238536298 TCTCCTTCCTCATGAGTCCATGG + Intergenic
1064392769 10:14955790-14955812 TCCCCCTCCTCAAGATTTCATGG - Intergenic
1066780130 10:38936282-38936304 TCTCTGCCCTCATAATCACAAGG - Intergenic
1067341846 10:45412172-45412194 TCTCCTTTCTCATGCTCAGATGG + Exonic
1070784185 10:79153674-79153696 TCTCCCTCCTCATGACCCATTGG + Intronic
1071160861 10:82743616-82743638 TCTCCTTCCTCATGTTCCCAGGG + Intronic
1073106826 10:101036940-101036962 TCTCCCACCTGAGGATCCCAGGG - Intronic
1077055795 11:592404-592426 TCTCCCTCCACGTGTACACAGGG - Intronic
1077996103 11:7453915-7453937 TCGCCCTCCTCAGGAGCACCAGG + Intronic
1078493722 11:11795168-11795190 TCTCTGTCTTCATGTTCACATGG - Intergenic
1079263573 11:18908124-18908146 GCTCCCACCTGATAATCACAGGG - Intergenic
1081055528 11:38406065-38406087 TCTTCCTACTCATGCTTACAAGG + Intergenic
1081220137 11:40449908-40449930 TCACACTCCTCATGTTCTCAGGG - Intronic
1082697078 11:56381491-56381513 TCTCCCTGCTTATTATCAGAAGG - Intergenic
1082921704 11:58502513-58502535 TCTCCCTCCTGTTCATAACATGG - Intergenic
1084490236 11:69474546-69474568 TCCCCCTCCAGATGAGCACAGGG + Intergenic
1088816126 11:113422171-113422193 TCTCCTTCCTCTTTATCCCAAGG + Intronic
1089490103 11:118877622-118877644 GCTCCCTCCACAAGACCACACGG - Intergenic
1090668869 11:128932286-128932308 GCTCCCTCCTAGTGATCAGATGG - Intergenic
1091239432 11:134042698-134042720 CCTCCTTCATCATGATGACATGG - Intergenic
1092266655 12:6986264-6986286 TCTTCCTCCTCATGATCTTCAGG - Intronic
1094241366 12:28229521-28229543 TCTTCCTCCTGATGTTTACATGG - Intronic
1096000340 12:48124571-48124593 TCTCACTGCTCAGGATCAGAAGG - Intronic
1097961194 12:65533449-65533471 CCTCCTTCCTCAGGATCAAAAGG + Intergenic
1098090001 12:66891556-66891578 TCTGCATCCTCCTCATCACAGGG + Intergenic
1098321865 12:69253459-69253481 TCTCCCATCTCTTAATCACAGGG - Intronic
1099368523 12:81800144-81800166 TCTTCCTCCTCATGCAAACATGG - Intergenic
1099768093 12:87016334-87016356 TCTGTCTCTTCATGATCACAGGG + Intergenic
1099769523 12:87033491-87033513 TTTTCCTCCTTCTGATCACATGG + Intergenic
1100206605 12:92356612-92356634 TCTTCCCCTTCATGACCACAGGG + Intergenic
1102193244 12:111005181-111005203 TGTCTCCCCTCATGGTCACAAGG - Intergenic
1102331274 12:112033153-112033175 TCTCTCTCATCTTTATCACAAGG - Intronic
1102508167 12:113397164-113397186 TCTCCCTGCCCAAGATCACCAGG - Exonic
1104093217 12:125533199-125533221 ACTTCATCCTCATGATAACAAGG - Intronic
1108152183 13:47547776-47547798 TCTACCTCCTCCTGATGATATGG - Intergenic
1112303757 13:98254499-98254521 TCTTCGTGCTCATGATCACTGGG - Intronic
1112503509 13:99959529-99959551 TCTCGCTCCTTTTGACCACATGG - Intergenic
1112732472 13:102380521-102380543 TCTACCTACTTATGATGACAGGG + Intronic
1113319222 13:109215580-109215602 GCACCCTCCTCCTGCTCACAGGG + Intergenic
1113892990 13:113746205-113746227 GCTCCCTGCTCAGGAACACAAGG - Intergenic
1116400208 14:44497265-44497287 TCTGGCTCCTCATTATCACTGGG - Intergenic
1116978567 14:51142882-51142904 ACTCCCTCCTCTTGACCAAAGGG - Intergenic
1117743338 14:58841956-58841978 TCTCCCTCCCCATCCCCACACGG - Intergenic
1120093640 14:80363310-80363332 TCTCCCACATCATGAGAACATGG - Intronic
1121297456 14:92840870-92840892 CCTCCCACCTCAGGCTCACAAGG + Intergenic
1122659708 14:103287205-103287227 TCTCCCTCCTCAGGAAAACGAGG + Intergenic
1123162086 14:106288091-106288113 GCCCCCTCCTCAGGATTACAGGG - Intergenic
1123180127 14:106461495-106461517 GCCCCCTCCTCAGGATTACAGGG - Intergenic
1202937121 14_KI270725v1_random:99951-99973 TCTCTGCCCTCATAATCACATGG + Intergenic
1123396082 15:19937923-19937945 TCTCTGCCCTCATAATCACATGG - Intergenic
1124562979 15:30792138-30792160 TGTCCCTCCCCATGACCAGAAGG + Intergenic
1126138609 15:45417378-45417400 TATCCCACCTCCAGATCACAAGG + Exonic
1126282652 15:46974228-46974250 TATCTCTCCTCATGATCAGGAGG + Intergenic
1128778959 15:70345384-70345406 TCTCCCATCTCATGATGGCAAGG - Intergenic
1130081476 15:80737752-80737774 TCTCCCTCCTTGTCATCACCTGG - Intronic
1130694551 15:86117688-86117710 TTTCCCTCCTGATCATCAAATGG + Intergenic
1132212777 15:100036741-100036763 TCTCCCTCCTCATTAGCACTAGG + Intronic
1134361819 16:13538202-13538224 TGTCCCCTCTCATGATCCCATGG + Intergenic
1135177796 16:20246334-20246356 TCTCCATCCACATGCTCAGATGG - Intergenic
1135978044 16:27124071-27124093 TCTCCATCCCCTTGAACACAGGG + Intergenic
1136698551 16:32110070-32110092 TCTCTGTCCTCATAATCACATGG - Intergenic
1136769052 16:32817764-32817786 TCTCTGTCCTCATAATCACATGG + Intergenic
1136799054 16:33053364-33053386 TCTCTGTCCTCATAATCACATGG - Intergenic
1138122471 16:54411637-54411659 TCACCTTCCTTATGATCTCAGGG - Intergenic
1140648438 16:77060721-77060743 TCTTCCTCCAGATAATCACATGG - Intergenic
1141954054 16:87358435-87358457 TCTCCCTGATTATGAGCACATGG - Intronic
1203071469 16_KI270728v1_random:1079871-1079893 TCTCTGTCCTCATAATCACATGG + Intergenic
1143020428 17:3914697-3914719 TCTCCTTCCTCACCATCACAAGG - Intronic
1143787107 17:9264108-9264130 TCTGTCTTCTCATGATCTCAGGG - Intronic
1144355997 17:14446915-14446937 TCAGCCTCCTCAGGACCACATGG - Intergenic
1145692707 17:26760332-26760354 TCTCTGCCCTCATAATCACATGG - Intergenic
1145709446 17:26956975-26956997 TCTCTGCCCTCATAATCACATGG - Intergenic
1148089403 17:45013788-45013810 GGTCCCTCCTCACTATCACAGGG + Intergenic
1148357408 17:46984668-46984690 TCCCCCTCCTCCAGATCTCAAGG + Intronic
1148578541 17:48727907-48727929 TCTCCCTCCTCCTCCTCCCAGGG + Intronic
1150883257 17:69055712-69055734 TCATCCTTCTCATGCTCACATGG + Intronic
1152979454 18:262086-262108 TCTTCCTCCTCTTTACCACATGG + Intronic
1153818022 18:8807813-8807835 CCTCCCTCCTCATGATCAAGGGG - Intronic
1154518814 18:15203782-15203804 TCTCTTCCCTCATAATCACATGG + Intergenic
1157574538 18:48734702-48734724 TCACCCACCTCATGACCCCAGGG + Intronic
1157631206 18:49097991-49098013 TTTCCCTTATCATGATCACCAGG + Intronic
1158894851 18:61903157-61903179 TCTCCCACCTCAGGCTCCCAAGG - Intergenic
1164917353 19:32062553-32062575 TCTCCCGCCTCAGGTTCCCAAGG - Intergenic
1167334125 19:48874149-48874171 TCACCCTCCTCTTCATCACTGGG - Exonic
1202682710 1_KI270712v1_random:23250-23272 TCTCTGCCCTCATAATCACATGG - Intergenic
925073285 2:988029-988051 TCTTCCTCCTCATCACCTCATGG + Intronic
925326481 2:3026047-3026069 TCTCTGCCCTCATGTTCACATGG - Intergenic
926240378 2:11080719-11080741 TCCTCCTCATCATGATCACTGGG + Intergenic
926795546 2:16616201-16616223 TCTCCCTCCTCCTGACTCCAGGG + Intronic
927006469 2:18854910-18854932 TATCCATCCTCAAGATCACAAGG + Intergenic
928129581 2:28640144-28640166 TCTGCCTGCTCCTGACCACAGGG - Intronic
930606839 2:53501792-53501814 TGTCCATCTTCATGTTCACATGG + Intergenic
930614344 2:53578180-53578202 TCTCCCTCAAGATGATCACTGGG - Intronic
934094415 2:88585840-88585862 TTTCCATCCTCATCCTCACAGGG - Exonic
934249090 2:90331925-90331947 TCTCTGCCCTCATAATCACATGG + Intergenic
934260487 2:91471549-91471571 TCTCTGCCCTCATAATCACATGG - Intergenic
934303806 2:91803500-91803522 TCTCTGCCCTCATAATCACATGG - Intergenic
934329448 2:92049251-92049273 TCTCTGCCCTCATAATCACATGG + Intergenic
934467670 2:94279168-94279190 TCTCTGCCCTCATAATCACATGG + Intergenic
935541441 2:104353645-104353667 GCTTTCTCCTCATGATTACAAGG + Intergenic
936006664 2:108895012-108895034 ACTCACTCATCATCATCACAAGG + Exonic
937683180 2:124666546-124666568 TCTCCCTTCCCATCATGACAGGG + Intronic
938518815 2:132044283-132044305 TCTCTGCCCTCATAATCACATGG + Intergenic
938755954 2:134379051-134379073 TCTAAATCCTCATGATAACATGG + Intronic
938941433 2:136172947-136172969 TCTCCCTCCTCCCTGTCACAAGG + Intergenic
939643834 2:144672116-144672138 CCTCCCTTCTCATGCTCTCATGG + Intergenic
941127355 2:161600640-161600662 TCTCCCTTCTTGTGAACACAAGG - Intronic
942596801 2:177599288-177599310 TCTGCCTTCACATGACCACAAGG - Intergenic
944670682 2:201992058-201992080 TCTTTCTCCCCATGATGACAAGG + Intergenic
946701505 2:222418899-222418921 TCTCCACCTTCATCATCACATGG + Intergenic
947999432 2:234555601-234555623 TCTCCCTCCTCCCCAGCACATGG - Intergenic
948655500 2:239474435-239474457 TCATTCTCCTCATGACCACAGGG + Intergenic
1170010129 20:11713862-11713884 TCTCCCTCATCTTGACCTCAGGG + Intergenic
1171133594 20:22677337-22677359 TCTCTGCCCTCATGTTCACATGG - Intergenic
1173276939 20:41593287-41593309 TCTCCCTTGTGATGCTCACATGG + Intronic
1173436050 20:43033264-43033286 TCTCTCTCCTGATGGTCTCAAGG + Intronic
1173572327 20:44085435-44085457 TCTCCCGCTTCAGGATCACTTGG + Intergenic
1174269470 20:49356801-49356823 TATCCCTCCTGATGATCACATGG - Intergenic
1174658954 20:52193993-52194015 GCTCCCCCCTCATCCTCACATGG - Intronic
1176586202 21:8589156-8589178 TCTCTGCCCTCATAATCACATGG - Intergenic
1176742903 21:10621876-10621898 TCTCTGTCCTCATAATCACATGG - Intergenic
1178530744 21:33373553-33373575 TCTCCCTCCCTCTGATCTCAAGG + Intergenic
1178626821 21:34225310-34225332 TCTCCCTCCTCCTGCTGAGAGGG - Intergenic
1178684316 21:34699358-34699380 TCTCCCACCTCAGCCTCACAAGG + Intronic
1179818500 21:43922976-43922998 TCTTTCTCCCCATGCTCACACGG + Intronic
1179938420 21:44621099-44621121 TCACTCTCCTCAAGTTCACATGG - Intronic
1180269008 22:10566060-10566082 TCTCTGCCCTCATAATCACATGG - Intergenic
1180280833 22:10693287-10693309 TCTCTGCCCTCATAATCACATGG - Intergenic
1181168328 22:20994911-20994933 ACTCCTTCATCATGATCACCTGG - Exonic
1183718282 22:39547083-39547105 TCTCCCTCTCCATGCCCACAGGG - Intergenic
1184154149 22:42656140-42656162 TCTTCCTCCACATGTTCTCAAGG - Intergenic
1203237931 22_KI270732v1_random:24788-24810 TCTCTGCCCTCATAATCACATGG - Intergenic
1203289725 22_KI270735v1_random:23575-23597 TCTCTGCCCTCATAATCACATGG + Intergenic
949390742 3:3559408-3559430 TCTCCCTCCCCATGAAGGCAGGG + Intergenic
950521835 3:13502009-13502031 TCTCCCTCCTCATGTCCCCACGG + Intronic
951819766 3:26795075-26795097 TCTCCCTCCTCCCAACCACAGGG - Intergenic
951969261 3:28424824-28424846 TGTCCCTCCTAATTATCACATGG - Intronic
954444143 3:50537619-50537641 TCTCCCTCCTCTTGAACACAAGG + Intergenic
954468342 3:50671257-50671279 TCTGCCTTCTCTTGATCAGAAGG - Intergenic
954799824 3:53180842-53180864 TCTCTCTCCGCATGTGCACACGG + Intronic
959546694 3:107604713-107604735 TCTCCTTCCCCATGCTTACATGG + Intronic
960739103 3:120813143-120813165 CCTCCCTCCTTCTCATCACATGG + Intergenic
961324552 3:126102545-126102567 TCTTGCTACTCATGATCCCAGGG - Intergenic
962279476 3:134039256-134039278 CCTCCCTGTTCATGGTCACAGGG + Intronic
963391000 3:144664281-144664303 TCTCCGCCTTCATGTTCACATGG - Intergenic
966215559 3:177498537-177498559 CCTCCCTCCGCATGTCCACAGGG - Intergenic
967185060 3:186937655-186937677 ACTCCCTCCTCAAGGTCGCACGG - Intronic
967204542 3:187107596-187107618 TCTACGTCCTCATGATGTCAGGG + Intergenic
967256485 3:187597938-187597960 TCTCCCTGAGCTTGATCACATGG + Intergenic
968132393 3:196199141-196199163 TTTCCCTAACCATGATCACATGG + Intronic
968405563 4:336925-336947 TCTCCCTCCCCAAGCTCACCCGG - Intergenic
968506830 4:974585-974607 TCTCCCCCCTCACCATCTCAGGG - Intronic
968989623 4:3900857-3900879 TGTTCCTCCTAATGTTCACATGG + Intergenic
974351305 4:60750480-60750502 TCTCCCTTCCCATCATCACTGGG + Intergenic
980451096 4:132972931-132972953 TCTCTGTCTTCATGATCACATGG - Intergenic
983972857 4:173895617-173895639 TCTCCCTCTTCATGACATCACGG + Intergenic
984708924 4:182868492-182868514 TCTCCCTCCTCATGGGCACTGGG + Intergenic
985787852 5:1909129-1909151 TCTCCCTCCTGTCTATCACAAGG + Intergenic
985820080 5:2153624-2153646 TTTCCCTCCTCATGCCCCCATGG - Intergenic
985927930 5:3032228-3032250 TCTCCCCCTTCATGGGCACACGG - Intergenic
986611466 5:9572285-9572307 TCTCCCTCCCCTTCTTCACATGG + Intergenic
988782409 5:34534359-34534381 TCTCCCAGCTCATGAGCTCATGG + Intergenic
992757685 5:79924017-79924039 TCTTCCTTATCATGACCACAAGG - Intergenic
994097786 5:95862728-95862750 TCTCCCTCCTCCAGAGCACATGG + Intergenic
994363094 5:98878189-98878211 TCTTCCTTCTCATGAGCACCTGG - Intronic
996311230 5:122108077-122108099 TCTTTCTACTCACGATCACAGGG + Intergenic
996685749 5:126278906-126278928 TCTCCCTCCTCAGCCTCCCAAGG + Intergenic
997941679 5:138163316-138163338 TCTTCCTCCTCATCCTCACCTGG + Exonic
998448684 5:142217959-142217981 TTTCTCTCCTGATGGTCACAGGG + Intergenic
999098623 5:149004202-149004224 TATCACTCCTCATGCTCACAGGG - Intronic
1000200742 5:159007998-159008020 TCTCCCACATCATGATTAAATGG - Intronic
1001874221 5:175185455-175185477 TCTCACTCTTCATGATTACATGG - Intergenic
1002330428 5:178436987-178437009 TCCCCCTCCCTAAGATCACAAGG + Intronic
1003171580 6:3725259-3725281 CCTCCCTCCTCATGTCCTCAGGG - Intronic
1003755564 6:9115843-9115865 TCTCTCTCCCCAAGATCTCAAGG - Intergenic
1004452473 6:15759351-15759373 TCTCCCTGTTCATATTCACATGG - Intergenic
1006397546 6:33796996-33797018 GCTCCCTCCTCAGGAGCCCAGGG + Intronic
1006919078 6:37615678-37615700 CCTCCCTCCTCATCCTCACATGG - Intergenic
1007111693 6:39316533-39316555 TCTCCCTCTTCCTCATAACAAGG + Intronic
1008225510 6:48910207-48910229 TCTCTGTCTTCATGTTCACATGG - Intergenic
1008989748 6:57588534-57588556 TTTCCCTCCTCTTGAGCACTGGG + Intronic
1009178332 6:60487078-60487100 TTTCCCTCCTCTTGAGCACTGGG + Intergenic
1011613505 6:89176831-89176853 TCTTCTTCCTCATGATCACTAGG - Intergenic
1014288164 6:119527107-119527129 TCTCTCTACTCATGCTGACATGG - Intergenic
1014405287 6:121043473-121043495 AATTCCTCCTCATCATCACAAGG - Intergenic
1015879129 6:137853399-137853421 TCTCCCTCCATAGGATAACAGGG - Intergenic
1017496664 6:154989617-154989639 TCTCCCTCCTGAAGATCACTTGG - Intronic
1018299459 6:162385613-162385635 TCTCCTTTCTCATCTTCACAAGG + Intronic
1019304715 7:327811-327833 TCTCTCTCCCCATGGTCTCAGGG - Intergenic
1019598519 7:1869540-1869562 TCTCCAACCTCAGTATCACAGGG + Intronic
1020312442 7:6878909-6878931 TGTTCCTCCTAATGTTCACATGG + Intergenic
1020886250 7:13822360-13822382 TCTCTGTCTTCATGTTCACATGG + Intergenic
1021813953 7:24429707-24429729 TCTGTCACCTCTTGATCACAAGG + Intergenic
1021860735 7:24903735-24903757 AGTCCCTCCTCCTGGTCACATGG + Intronic
1024363100 7:48489706-48489728 TGTCCCTCCTCCTTATCACTGGG + Intronic
1024804880 7:53127122-53127144 TCTCTGCCCTCATAATCACATGG + Intergenic
1025481250 7:60986255-60986277 TCTCTGCCCTCATAATCACATGG - Intergenic
1026429554 7:70330740-70330762 TCTCCCAACCCATGAACACAGGG + Intronic
1028447887 7:90945621-90945643 TCTCCTTCCTTATGATCATTTGG + Intronic
1030296221 7:107930735-107930757 TCTAGCTCCTCATGGTTACAAGG - Intronic
1031766331 7:125781903-125781925 TATCCATCCTCATGGTCATATGG - Intergenic
1034041799 7:147885583-147885605 TCTCTCTCCTTATGTTCAGAAGG + Intronic
1034212383 7:149375307-149375329 TTTCCCTCCGCATGATTACTAGG + Intergenic
1034927727 7:155136163-155136185 TCTCCCTCCTCAGCTTCCCAAGG - Intergenic
1035218961 7:157393555-157393577 TCACCCTCCTCAAGATCACAGGG - Intronic
1035625538 8:1067962-1067984 CCTCCCTCCTCATGAACCCTTGG + Intergenic
1035968134 8:4217497-4217519 TCTCCCTCCCCTTGATGCCAGGG - Intronic
1036651987 8:10650163-10650185 GCTTTCTCCTCATGATCACGTGG - Intronic
1041030173 8:53728715-53728737 CCTTCCTCCTCCTCATCACATGG + Intronic
1044524994 8:93241725-93241747 TCTGCCTCCTCATGATGCCCAGG + Intergenic
1045816249 8:106280482-106280504 TCTCCATCTTCATCATCTCATGG + Intronic
1047735932 8:127765032-127765054 TCTCCCTCCTCCTGGGAACATGG + Intergenic
1048220244 8:132534349-132534371 CCTACCTCCTCATGCTCACCTGG + Intergenic
1048395442 8:134010154-134010176 TGTCCCTCTGCATGACCACAAGG - Intergenic
1049277696 8:141728168-141728190 TCCCCCTTCTCATGAGCACAGGG + Intergenic
1049508110 8:143014572-143014594 ACTCCCTCCTCCTCCTCACACGG - Intergenic
1049508247 8:143015112-143015134 ACTCCCTCCTCCTCCTCACACGG - Intergenic
1049508258 8:143015157-143015179 ACTCCCTCCTCCTCCTCACATGG - Intergenic
1049508382 8:143015625-143015647 ACTCCCTCCTCCTCCTCACACGG - Intergenic
1049508393 8:143015670-143015692 ACTCCCTCCTCCTCCTCACATGG - Intergenic
1049508413 8:143015757-143015779 ACTCCCTCCTCCTCCTCACATGG - Intergenic
1049508424 8:143015802-143015824 ACTCCCTCCTCCTCCTCACACGG - Intergenic
1050846417 9:10226328-10226350 TCTCCACTCTCATGGTCACAGGG - Intronic
1052180214 9:25517550-25517572 TCTCCCTCCTCAGCCTCCCAAGG - Intergenic
1052342657 9:27378965-27378987 TCTGCCTCCTCAGGGTCAGAAGG + Intronic
1053698086 9:40657240-40657262 TCTCTGTCCTCATAATCACATGG + Intergenic
1053944094 9:43287448-43287470 TCTCTGCCCTCATAATCACATGG + Intergenic
1054309377 9:63456648-63456670 TCTCTGTCCTCATAATCACATGG + Intergenic
1054408172 9:64780770-64780792 TCTCTGTCCTCATAATCACATGG + Intergenic
1054441319 9:65264596-65264618 TCTCTGTCCTCATAATCACATGG + Intergenic
1054488958 9:65756893-65756915 TCTCTGTCCTCATAATCACATGG - Intergenic
1055068219 9:72140311-72140333 TCTCCCTCCTCATGATCACAAGG - Intronic
1055355738 9:75435410-75435432 GCTCCCTCCTCTTGCTCACAAGG + Intergenic
1055422812 9:76161906-76161928 TCTCCCTCATCAAGACCACCTGG + Intronic
1057986350 9:99718811-99718833 GCTACCTCCTTATGTTCACATGG - Intergenic
1059643631 9:116242091-116242113 TCTCTGGCCTCATGAGCACATGG + Intronic
1061122877 9:128654974-128654996 TCTCCCTCCTCGAGCTTACATGG - Intronic
1202780449 9_KI270717v1_random:30430-30452 TCTCTGTCCTCATAATCACATGG + Intergenic
1203582076 Un_KI270746v1:17576-17598 TCTCTGCCCTCATAATCACATGG - Intergenic
1203587229 Un_KI270747v1:16026-16048 TCTCTGCCCTCATAATCACATGG + Intergenic
1203616109 Un_KI270749v1:66671-66693 TCTCTGCCCTCATAATCACATGG - Intergenic
1185768919 X:2749759-2749781 TCTCCCACTTCATGTTCCCAAGG + Intergenic
1185828218 X:3273188-3273210 TCTCCGTCATAATGTTCACATGG + Intronic
1186064087 X:5742868-5742890 TCTCCTTCTTCATCATGACAGGG - Intergenic
1186672567 X:11781978-11782000 CCTCCCTCCACATGATGATAGGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189489637 X:41460024-41460046 TCTCCATCCTCATCAACATATGG + Intronic
1191972415 X:66831859-66831881 TCTCTCTCTTCAAGCTCACAGGG - Intergenic
1193667765 X:84344070-84344092 TCTCCTGCATCATCATCACAAGG - Intronic
1195112438 X:101660959-101660981 TCTCCCTCCTCCTCCTGACAGGG - Intergenic
1195129244 X:101838169-101838191 TCCCCTTCCTCATGGTCCCAGGG + Intronic
1195176991 X:102321661-102321683 TCCCCTTCCTCATGGTCCCAGGG - Intronic
1195181873 X:102365432-102365454 TCCCCTTCCTCATGGTCCCAGGG + Intronic
1195350206 X:103988440-103988462 TCTTCACCCTCATGATCCCAAGG + Intergenic
1195945988 X:110212293-110212315 TCCTCATCCTCATGACCACAGGG + Intronic
1199778209 X:151034167-151034189 TCTCCCTCCTCTTGAGCCCCAGG - Intergenic
1200858061 Y:7960456-7960478 AATTCCTCCTCATGATCAGAAGG + Intergenic