ID: 1055069316

View in Genome Browser
Species Human (GRCh38)
Location 9:72149879-72149901
Sequence CGCCACTGCTCCCGACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055069316_1055069320 11 Left 1055069316 9:72149879-72149901 CCCAGAAGTCGGGAGCAGTGGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1055069320 9:72149913-72149935 CAACTGGCTCGACAGCAGTCCGG No data
1055069316_1055069322 18 Left 1055069316 9:72149879-72149901 CCCAGAAGTCGGGAGCAGTGGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1055069322 9:72149920-72149942 CTCGACAGCAGTCCGGGCTGCGG No data
1055069316_1055069321 12 Left 1055069316 9:72149879-72149901 CCCAGAAGTCGGGAGCAGTGGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1055069321 9:72149914-72149936 AACTGGCTCGACAGCAGTCCGGG No data
1055069316_1055069318 -5 Left 1055069316 9:72149879-72149901 CCCAGAAGTCGGGAGCAGTGGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1055069318 9:72149897-72149919 TGGCGTGCTAACGCCACAACTGG No data
1055069316_1055069323 27 Left 1055069316 9:72149879-72149901 CCCAGAAGTCGGGAGCAGTGGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1055069323 9:72149929-72149951 AGTCCGGGCTGCGGTAGAGCCGG No data
1055069316_1055069324 28 Left 1055069316 9:72149879-72149901 CCCAGAAGTCGGGAGCAGTGGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1055069324 9:72149930-72149952 GTCCGGGCTGCGGTAGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055069316 Original CRISPR CGCCACTGCTCCCGACTTCT GGG (reversed) Intronic