ID: 1055069319

View in Genome Browser
Species Human (GRCh38)
Location 9:72149910-72149932
Sequence GACTGCTGTCGAGCCAGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055069319_1055069324 -3 Left 1055069319 9:72149910-72149932 CCACAACTGGCTCGACAGCAGTC No data
Right 1055069324 9:72149930-72149952 GTCCGGGCTGCGGTAGAGCCGGG No data
1055069319_1055069323 -4 Left 1055069319 9:72149910-72149932 CCACAACTGGCTCGACAGCAGTC No data
Right 1055069323 9:72149929-72149951 AGTCCGGGCTGCGGTAGAGCCGG No data
1055069319_1055069326 4 Left 1055069319 9:72149910-72149932 CCACAACTGGCTCGACAGCAGTC No data
Right 1055069326 9:72149937-72149959 CTGCGGTAGAGCCGGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055069319 Original CRISPR GACTGCTGTCGAGCCAGTTG TGG (reversed) Intronic