ID: 1055069323

View in Genome Browser
Species Human (GRCh38)
Location 9:72149929-72149951
Sequence AGTCCGGGCTGCGGTAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055069317_1055069323 26 Left 1055069317 9:72149880-72149902 CCAGAAGTCGGGAGCAGTGGCGT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1055069323 9:72149929-72149951 AGTCCGGGCTGCGGTAGAGCCGG No data
1055069319_1055069323 -4 Left 1055069319 9:72149910-72149932 CCACAACTGGCTCGACAGCAGTC No data
Right 1055069323 9:72149929-72149951 AGTCCGGGCTGCGGTAGAGCCGG No data
1055069316_1055069323 27 Left 1055069316 9:72149879-72149901 CCCAGAAGTCGGGAGCAGTGGCG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1055069323 9:72149929-72149951 AGTCCGGGCTGCGGTAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055069323 Original CRISPR AGTCCGGGCTGCGGTAGAGC CGG Intronic