ID: 1055076294

View in Genome Browser
Species Human (GRCh38)
Location 9:72218593-72218615
Sequence CCCTGCAGGCATAAACTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055076287_1055076294 7 Left 1055076287 9:72218563-72218585 CCATTTCATAGTCTTTACAGTTG 0: 1
1: 0
2: 0
3: 21
4: 304
Right 1055076294 9:72218593-72218615 CCCTGCAGGCATAAACTGGTGGG No data
1055076286_1055076294 27 Left 1055076286 9:72218543-72218565 CCTAGGGAGGGCAGAAAGAGCCA 0: 1
1: 0
2: 2
3: 46
4: 310
Right 1055076294 9:72218593-72218615 CCCTGCAGGCATAAACTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055076294 Original CRISPR CCCTGCAGGCATAAACTGGT GGG Intronic
No off target data available for this crispr