ID: 1055078462

View in Genome Browser
Species Human (GRCh38)
Location 9:72242222-72242244
Sequence CCAAATGCATGGTCTTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055078462_1055078467 14 Left 1055078462 9:72242222-72242244 CCCTGCCAAGACCATGCATTTGG 0: 1
1: 0
2: 0
3: 33
4: 339
Right 1055078467 9:72242259-72242281 TACACTAATTACTCTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055078462 Original CRISPR CCAAATGCATGGTCTTGGCA GGG (reversed) Intronic
900790859 1:4679566-4679588 CCAAAATCAAGGTGTTGGCAGGG + Intronic
900835046 1:4996637-4996659 GAAAATGCATGGGCTGGGCATGG - Intergenic
900874909 1:5335235-5335257 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
901355772 1:8647104-8647126 CCAACAGCAAGGTGTTGGCAGGG - Intronic
902226632 1:15000308-15000330 CCAAAATCAGGGTGTTGGCAGGG - Intronic
903078817 1:20792429-20792451 CAGAATGTATGGTCTTGGCAGGG + Intergenic
903644600 1:24886986-24887008 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
904824320 1:33264754-33264776 CCAGATGCATGGTCTTGGGCAGG + Intronic
905342326 1:37287789-37287811 CCATATGCATGGCCATGGCTGGG + Intergenic
905636143 1:39554149-39554171 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
906261028 1:44390234-44390256 GCAAATGGAAGGTTTTGGCAGGG + Intergenic
908112931 1:60915078-60915100 CCAAAATCAAGGTATTGGCAAGG - Intronic
909118146 1:71566102-71566124 CCAAAACCAAGGTTTTGGCAGGG - Intronic
909837010 1:80268453-80268475 TGAAATGTATGGTCTTGACATGG + Intergenic
911095749 1:94053696-94053718 CCAAAATCAAGGTGTTGGCAGGG - Intronic
911595036 1:99789931-99789953 CCAAAGTCAAGGTCTTGGCAGGG + Intergenic
911826933 1:102498784-102498806 CCAAACTCAAGGTGTTGGCAAGG + Intergenic
911882159 1:103253610-103253632 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
912366282 1:109136442-109136464 CCAAAATCAAGGTGTTGGCAGGG - Intronic
913057336 1:115174734-115174756 CCAAAATCAAGGTATTGGCAGGG + Intergenic
913135267 1:115882366-115882388 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
914254939 1:145954225-145954247 CCAAAATCAAGGTGTTGGCAGGG - Intronic
915556120 1:156661726-156661748 ACACATGCAGGGGCTTGGCAGGG - Intergenic
915674476 1:157517635-157517657 CTAAAATCATGGTGTTGGCAGGG - Intronic
916011624 1:160711534-160711556 CCAATAGCATGGCCATGGCATGG - Intronic
916809882 1:168296078-168296100 GCATCTGCATGGACTTGGCAGGG - Intronic
918580709 1:186124810-186124832 CCAAATTCATTGTTTTGGGAAGG + Intronic
918739867 1:188115555-188115577 CCAAATGTCTGGTTCTGGCAAGG - Intergenic
918837396 1:189484840-189484862 CCAGCTGCATGATCTTGGGACGG - Intergenic
919817734 1:201452111-201452133 CCAAAGTCAAGGTGTTGGCAAGG - Intergenic
922561715 1:226574603-226574625 CCAAATTCATGGCCTGAGCATGG + Intronic
923035711 1:230283773-230283795 CCAAATGCAGGCTCTCGGCCTGG + Intergenic
923060075 1:230463842-230463864 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
923624687 1:235604449-235604471 CCAAAATCAAGGTGTTGGCAGGG + Intronic
923699181 1:236283368-236283390 CCAAATGCAGGGTCCTGGGGTGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063234116 10:4094478-4094500 CTAAAAGCAGGCTCTTGGCAGGG + Intergenic
1063798896 10:9548125-9548147 CCAAACACACAGTCTTGGCATGG + Intergenic
1064355085 10:14609314-14609336 CCAAAATCAAGATCTTGGCAGGG + Intronic
1064601538 10:16998476-16998498 CCAAAGTCAAGGTGTTGGCAGGG - Intronic
1066388895 10:34963155-34963177 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1067976048 10:51026174-51026196 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1069635250 10:69921109-69921131 CCAAAAGCAAGGTGTTAGCAGGG + Intronic
1071868265 10:89762536-89762558 CCCAATGCATTGTCTTGGATAGG + Intronic
1072030347 10:91515098-91515120 CCAAATGAATGGTTTTGGAGAGG - Intergenic
1072168374 10:92836475-92836497 CCCACTGCATGGTCGTGACAGGG - Intronic
1075512045 10:123080517-123080539 CCAAAGACATAGGCTTGGCAGGG - Intergenic
1076414284 10:130274218-130274240 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1078428577 11:11270271-11270293 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1079167581 11:18060431-18060453 CCAAATGCCTTGTCTTGTTAAGG - Intergenic
1079248650 11:18771628-18771650 CCAAATGCAGGGTAGTGGCAGGG + Intronic
1079612421 11:22449681-22449703 CCAAAAGCAAGGTGTTGGCAGGG - Intergenic
1080182417 11:29441427-29441449 CAAAATGCATGGTTTTGGCTTGG + Intergenic
1080764895 11:35286782-35286804 CCAAATGAATGGTGTTGTCCTGG - Exonic
1084073713 11:66755705-66755727 CCAAAATCAAGGTCTTGGTATGG + Intronic
1084081909 11:66832860-66832882 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1084718514 11:70889346-70889368 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1088017053 11:105073565-105073587 CCAGATACATGGTCTAGTCATGG - Intronic
1088574855 11:111260694-111260716 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1089522383 11:119073838-119073860 CCAGATGCTGGCTCTTGGCAAGG - Exonic
1091533941 12:1387729-1387751 CCAAAAGTATGGTGTTGGCAGGG - Intronic
1091654707 12:2337163-2337185 CCAAAACCTTGGTCTTGGAAGGG - Intronic
1093984157 12:25509909-25509931 CTAAAAGCAAGGTGTTGGCAAGG - Intronic
1094616838 12:32043540-32043562 CCAAAATCAAGGTCTTGGCAGGG + Intergenic
1096493806 12:52027516-52027538 CCAAGTGCTTGCTCTGGGCAAGG - Intronic
1098835310 12:75417380-75417402 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1099880028 12:88456569-88456591 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1100365103 12:93913056-93913078 CCAAGAGCAAGGTGTTGGCAGGG - Intergenic
1100726767 12:97417270-97417292 CCAAAGTCAGGGTGTTGGCAGGG + Intergenic
1101002237 12:100368177-100368199 CCAAACCCAAGGTGTTGGCAGGG + Intronic
1102206298 12:111093137-111093159 CCAACTGCATGGCCTTGGGCAGG - Intronic
1102586853 12:113929729-113929751 CCACATGCCTGGTCATGGCAGGG - Intronic
1102770541 12:115472251-115472273 CTAAAATCAAGGTCTTGGCAGGG - Intergenic
1103676061 12:122656744-122656766 CCTACAGCGTGGTCTTGGCAAGG + Intergenic
1106085831 13:26540672-26540694 GCAGAGACATGGTCTTGGCAAGG - Intergenic
1107107152 13:36656726-36656748 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1108920381 13:55665835-55665857 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1109689877 13:65872416-65872438 CCAAATTCAAGGAATTGGCAAGG - Intergenic
1110550359 13:76805123-76805145 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1111099160 13:83558833-83558855 CCAAACTCAAGGTTTTGGCAGGG - Intergenic
1111769233 13:92575491-92575513 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1111805724 13:93038876-93038898 ACAAAAGCATGGGCCTGGCATGG + Intergenic
1112086753 13:96040249-96040271 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1113526337 13:110980811-110980833 AGAAATGCATGGGCTGGGCATGG + Intergenic
1115705108 14:35990425-35990447 ACAAAAGCATGGTCTAGGCCAGG + Intergenic
1115876256 14:37865142-37865164 CCAAGTGCATGAGTTTGGCAGGG + Intronic
1115888215 14:37997783-37997805 CCTGATGCATGTTCTTGTCATGG + Intronic
1115962391 14:38850155-38850177 CCAAAATCATAGTTTTGGCAGGG - Intergenic
1117815457 14:59593159-59593181 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1118167948 14:63356594-63356616 CCAAAAGCAAGGTGTGGGCAGGG + Intergenic
1118425115 14:65652138-65652160 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1119080037 14:71684427-71684449 CCAAAGGCCTGGTCTTGACGTGG - Intronic
1119334211 14:73818969-73818991 CCAAAATCAGGGTGTTGGCAAGG + Intergenic
1120827576 14:88969507-88969529 CTAAAATCAAGGTCTTGGCAGGG - Intergenic
1121567674 14:94922979-94923001 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1121626337 14:95388107-95388129 CCAAAATCAAGGTCTTAGCAGGG + Intergenic
1121795596 14:96732789-96732811 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1121900116 14:97686220-97686242 CAGAAGGCAAGGTCTTGGCAGGG + Intergenic
1122317698 14:100835637-100835659 CCACAGGTATGGGCTTGGCAGGG - Intergenic
1122690798 14:103531423-103531445 CCAACTGCAGGGCCTCGGCACGG - Intronic
1123758638 15:23416150-23416172 CCAAAACCAAGGTGTTGGCAGGG - Intergenic
1124468757 15:29964563-29964585 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1124576201 15:30910675-30910697 CCAAGTGGAAGGTCTTGGCTAGG - Exonic
1126716484 15:51523764-51523786 TCAAATTCAAGGTGTTGGCAAGG - Intronic
1126918010 15:53487411-53487433 CCAAGTGTCTGGTCTTGGGAGGG - Intergenic
1127451009 15:59116371-59116393 GCAATTGAATGATCTTGGCATGG + Intronic
1128132404 15:65237689-65237711 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1128396402 15:67230582-67230604 CCAAAATCAGGGTGTTGGCAGGG - Intronic
1130697457 15:86144932-86144954 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1131540132 15:93268818-93268840 TGAAAAGCATGGTCTTGGCCGGG - Intergenic
1133336356 16:5009059-5009081 CCAAAACCAAGGTGTTGGCAGGG + Intronic
1133510626 16:6453959-6453981 CCAAATCCAAGGCGTTGGCATGG + Intronic
1134357099 16:13492445-13492467 ACAAATGGGTGTTCTTGGCAAGG + Intergenic
1134457697 16:14406711-14406733 CCAAAACCAAGGTGTTGGCAGGG + Intergenic
1135138458 16:19901975-19901997 CCAAAATCAAGGTATTGGCAGGG - Intergenic
1135235592 16:20752477-20752499 TCAAAAGCCTGGTCTTGGCTGGG + Intronic
1135343211 16:21666155-21666177 ACAAATGCTTGGTGTTGGAATGG - Intergenic
1136055384 16:27684652-27684674 CTAAATTCAAGGTGTTGGCAAGG + Intronic
1138056662 16:53841540-53841562 CCAAGTTCATGGTCTCTGCAAGG - Intronic
1138725970 16:59139538-59139560 CCAAAATCAAGGTATTGGCAGGG + Intergenic
1139239612 16:65377741-65377763 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1139332792 16:66206776-66206798 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1139655099 16:68382677-68382699 TCAAAGGCATGGCCCTGGCAAGG - Intronic
1140039632 16:71397431-71397453 CTAAAATCAAGGTCTTGGCAGGG - Intergenic
1140206254 16:72936055-72936077 CCAGCTGCATGATCTTGCCAGGG + Intronic
1140818961 16:78645815-78645837 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1141035006 16:80618992-80619014 CCAAACTCAAGGTGTTGGCAGGG + Intronic
1141310199 16:82906701-82906723 CCATATTCATGGTTTCGGCAGGG + Intronic
1145265054 17:21375986-21376008 CCACATGCATGATGTTCGCAGGG - Intergenic
1146177846 17:30678056-30678078 CCAAAGTCAAGGTGTTGGCAGGG + Intergenic
1146279541 17:31536395-31536417 CCAAAGTCATTTTCTTGGCATGG - Exonic
1146542152 17:33705713-33705735 CCAAAACCAAGGTGTTGGCAGGG - Intronic
1147423046 17:40332020-40332042 ACGCATGCATGGTCTTGGCAGGG + Intronic
1148376392 17:47150568-47150590 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1149646164 17:58243165-58243187 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1150447893 17:65241768-65241790 CCAAAGTCAAGGTTTTGGCAGGG - Intergenic
1150452947 17:65284407-65284429 CCAAAGTCAAGGTGTTGGCAAGG + Intergenic
1151491284 17:74433369-74433391 CCAAATGCCTGGTCTTGGTGCGG + Intronic
1153619572 18:6964502-6964524 CCAAAAGCAAGGTGTTGGCAGGG - Intronic
1154131705 18:11742560-11742582 CAGAATGCGTGTTCTTGGCACGG - Intronic
1156770038 18:40709034-40709056 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1157047226 18:44116502-44116524 CCAAAAACATGTTCTTTGCATGG + Intergenic
1158785152 18:60702681-60702703 CCACATGCATTGTAGTGGCAGGG + Intergenic
1159631925 18:70759054-70759076 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1160190511 18:76710925-76710947 ACAGATGCCTGCTCTTGGCAGGG + Intergenic
1160501698 18:79404450-79404472 CCAACAGCAAGGTCTTGGCGTGG + Intronic
1161238622 19:3209893-3209915 CCAAAGTCAGGGTGTTGGCAGGG + Intergenic
1161259786 19:3331381-3331403 TCAAATTCAAGGTGTTGGCAGGG + Intergenic
1161569816 19:5024345-5024367 TCAGATGCAGGGGCTTGGCAGGG - Intronic
1161822192 19:6536601-6536623 CCAAAGTCAAGGTCTTGACAGGG + Intergenic
1162132232 19:8533692-8533714 CCAAAATCAAGGTGTTGGCATGG - Intronic
1162980649 19:14237192-14237214 CCAAAGTCAAGGTGTTGGCAGGG - Intergenic
1164943906 19:32274076-32274098 CCAAAGGCATGGCCTTTTCAAGG - Intergenic
1165901590 19:39171947-39171969 CCTAGTGCATGCTCTGGGCAGGG - Intronic
1166996896 19:46723697-46723719 CCAAGTGCATGGGCTTTGCCTGG + Intronic
927114832 2:19889627-19889649 CCAAAATCAAGGTGTTGGCAAGG + Intergenic
927922750 2:26986062-26986084 CCAAAATCAAGGTGTTGGCAAGG + Intronic
928046868 2:27943084-27943106 CAAAATGTATGGTATGGGCAAGG - Intronic
929057225 2:37888810-37888832 CCAAAATCAAGGTATTGGCAGGG - Intergenic
930181865 2:48368140-48368162 CCAAATTCATGGTGTTGACACGG + Intronic
930192848 2:48478168-48478190 CCAAAATCAAGGTGTTGGCAGGG - Intronic
930386317 2:50699721-50699743 CCAAAGGCAAGGTGTTGGCAGGG - Intronic
931585012 2:63816622-63816644 CCAAAATCAGGGTGTTGGCAGGG - Intronic
931970891 2:67584934-67584956 CCAAAAGCTTGGTCTTTGAAAGG + Intergenic
931982166 2:67705445-67705467 CCAAAATCAGGGTGTTGGCAGGG - Intergenic
932941768 2:76175015-76175037 CCAAAGCCAAGGTGTTGGCAGGG + Intergenic
933733909 2:85479728-85479750 CCAAAATCAAGGTATTGGCAAGG - Intergenic
933795758 2:85918235-85918257 CCAACTGCCTGGCATTGGCATGG - Intergenic
933798514 2:85941253-85941275 CCAAAATCAAGGTATTGGCAAGG + Intergenic
934976208 2:98804398-98804420 CAATATGCATGGTGTTGGCATGG + Intronic
935156464 2:100487738-100487760 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
935635193 2:105244488-105244510 CTTAATGCATGCTCTTTGCATGG - Intergenic
936975537 2:118217878-118217900 GGTAATGCATGGTGTTGGCAAGG - Intergenic
937008458 2:118539986-118540008 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
937833348 2:126446504-126446526 CCAAATGCATTCTTTTGGCCTGG - Intergenic
939011535 2:136852466-136852488 CCTAAGGCATGGTGTTAGCAAGG - Intronic
939475380 2:142680117-142680139 CCAAAGTCAAGGTCTTGGTATGG - Intergenic
939506678 2:143055240-143055262 TCAAAAGCAAGGCCTTGGCAGGG + Exonic
940275228 2:151933015-151933037 CCAAAATCAAGGTGTTGGCAGGG - Intronic
941847044 2:170143408-170143430 CTAAATGCATGGCCTTGTCCAGG - Intergenic
941957446 2:171219199-171219221 CCAAAAGCAAGGTGTTGGCAGGG + Intronic
942684950 2:178521483-178521505 CCAAAATCAGGGTGTTGGCAGGG - Intergenic
944015754 2:195035170-195035192 CCAATTTCAGAGTCTTGGCAAGG + Intergenic
945580426 2:211587573-211587595 CCAAAATGATGGTGTTGGCAGGG - Intronic
946157291 2:217815367-217815389 CCAAAATCAAGGTGTTGGCAAGG - Intronic
948385684 2:237579190-237579212 CCCAATCCAGGGTCTAGGCAGGG - Intronic
1172888682 20:38248397-38248419 CCAAAAACAAAGTCTTGGCAGGG - Intronic
1173418412 20:42879246-42879268 CCAAAATCAGGGTATTGGCAGGG + Intronic
1173572227 20:44084891-44084913 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1174975745 20:55331829-55331851 CCAAATGCTGGGTTTTCGCATGG - Intergenic
1175127287 20:56762038-56762060 CTAAAAGCATGGTATTGGCAGGG + Intergenic
1175163168 20:57023764-57023786 CCAAAAGCAAGGTGTCGGCAGGG - Intergenic
1176513586 21:7766948-7766970 CCAAAGGCAAGCTGTTGGCAGGG - Intronic
1176910770 21:14561964-14561986 CCAAAATCAAGGTATTGGCAGGG - Intronic
1176970357 21:15258045-15258067 CCGAAAGCATGGTATTGACAGGG + Intergenic
1177379353 21:20318672-20318694 CCAAATACATGCTATTTGCAAGG + Intergenic
1177644047 21:23879448-23879470 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1178112631 21:29384068-29384090 CAAAATCCATTGTCTCGGCAGGG + Intronic
1178352223 21:31880387-31880409 CCAAAACCAAGGTGTTGGCAGGG + Intronic
1178352903 21:31885572-31885594 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1178647699 21:34397472-34397494 CCAAAGGCAAGCTGTTGGCAGGG - Intronic
1178731780 21:35110355-35110377 CGAAAAGCAAGGTTTTGGCAGGG + Intronic
1178786100 21:35655204-35655226 CTCAATCCATGGGCTTGGCATGG + Intronic
1179092954 21:38284712-38284734 CCACATGCAGGGGCATGGCATGG + Intronic
1179593853 21:42429220-42429242 CCAAAGTCAAGGTGTTGGCAGGG - Intronic
1183472663 22:38017780-38017802 CCAAACGCCTGGGCTGGGCAAGG - Intronic
1183799367 22:40148921-40148943 CCAAAATCAAGGTATTGGCAGGG - Intronic
1184866255 22:47203264-47203286 CCACATGCAGGGTTCTGGCAGGG + Intergenic
1184886160 22:47345552-47345574 CCAAAAGCAGGGTGTCGGCAGGG + Intergenic
1184976981 22:48069264-48069286 CCAAGATCATGGTGTTGGCAGGG + Intergenic
1184983279 22:48111073-48111095 CCTAGTGAATGGTCTTGGCACGG - Intergenic
951112867 3:18825226-18825248 CCAAAAGCAAGTTGTTGGCAGGG + Intergenic
951292425 3:20889492-20889514 ACAAATCCAAGGTCTGGGCAGGG - Intergenic
952967455 3:38630157-38630179 ACAAATGCATGGTCATGACCTGG - Intronic
953231229 3:41066636-41066658 CCAAAAACAGGATCTTGGCAGGG + Intergenic
954312194 3:49778335-49778357 AAAAAGGCAGGGTCTTGGCAAGG + Intronic
954397426 3:50300243-50300265 CCATATGCATCTACTTGGCAAGG - Exonic
954681664 3:52349387-52349409 CCTTATGCAGGTTCTTGGCAAGG - Exonic
955604842 3:60690353-60690375 CCAACCACTTGGTCTTGGCAGGG + Intronic
955654410 3:61229397-61229419 CCAAAATCAAGGTGTTGGCAGGG - Intronic
955692405 3:61603651-61603673 CCAAAATCAAGGTGTTGGCAAGG + Intronic
956515806 3:70046725-70046747 GCAAAATCATGGTGTTGGCAGGG + Intergenic
956751878 3:72350001-72350023 CCAATTGCATGGTGTTCCCAAGG - Intergenic
957417066 3:79918477-79918499 CCAAATGCTTTGTTTTGGAATGG + Intergenic
958482182 3:94656947-94656969 CCAAAGGCATGCTCTAGGCTGGG - Intergenic
960301125 3:116003856-116003878 CCAAAATCAAGGTATTGGCAGGG - Intronic
960312789 3:116136981-116137003 CCAAAACCAAGGTTTTGGCAAGG + Intronic
960504283 3:118473826-118473848 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
960606820 3:119514806-119514828 CCAAAGTCAAGGTCTTGGCCGGG + Intronic
962533335 3:136304013-136304035 CCAAGATCATGGTGTTGGCAGGG + Intronic
964982599 3:162703696-162703718 ACAAATGCATGGTCTGGTAAGGG + Intergenic
965292329 3:166899392-166899414 CCAAAATCAAGGTATTGGCAGGG - Intergenic
966031055 3:175348504-175348526 CCAAAATCAAGGTGTTGGCAGGG + Intronic
967047329 3:185749816-185749838 CCTAATTCATGCTCTTGGCTTGG - Intronic
967556484 3:190864250-190864272 TCAAGAGCATGGTGTTGGCAGGG - Intronic
967873013 3:194247974-194247996 CCAAAGTCAAGGTGTTGGCAGGG + Intergenic
968631939 4:1656360-1656382 CCAGGTGCATGGGCCTGGCATGG + Intronic
968897932 4:3415681-3415703 CCACACACCTGGTCTTGGCAAGG - Intronic
969047363 4:4346093-4346115 CCAAAGTCAAGGTGTTGGCAGGG + Intergenic
969206757 4:5652962-5652984 CCAAACTCAAGGTGTTGGCAGGG + Intronic
969433853 4:7172684-7172706 CCAAAGTCAAGGTGTTGGCAGGG + Intergenic
969552682 4:7881440-7881462 CCAAATGAGTGGCATTGGCAGGG - Intronic
971225838 4:24750840-24750862 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
972292776 4:37705318-37705340 CTAAAATCATGGTCTTGGCAGGG + Intergenic
972410954 4:38794043-38794065 CCAAAATCAAGGTGTTGGCAGGG - Intronic
972696281 4:41449841-41449863 CCAAAAGCAGAGTGTTGGCAGGG + Intronic
972716413 4:41650804-41650826 CCAAAACCAAGGTGTTGGCAGGG + Intronic
973604568 4:52573649-52573671 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
975746360 4:77479399-77479421 CCAAATGATTGTTCTTGCCAGGG - Intergenic
976029929 4:80740590-80740612 TGAAGTGCAGGGTCTTGGCAAGG - Intronic
977098573 4:92777818-92777840 CCAAAGTCAAGGTGTTGGCAGGG - Intronic
977912067 4:102548637-102548659 CCAATATCATGGTCTTCGCAGGG + Intronic
979617892 4:122765172-122765194 ACAAAGGCATAGTCTTGGAATGG - Intergenic
979863052 4:125718449-125718471 CCAAATGCAAGGTGTCAGCAGGG + Intergenic
982179768 4:152739143-152739165 CCAAAATCAAGGTGTTGGCAAGG + Intronic
982352704 4:154433319-154433341 CGAAATGAATGTACTTGGCAGGG - Intronic
983252080 4:165356960-165356982 CCAAATGAATGATCTTTTCATGG + Intergenic
984632259 4:182073463-182073485 CCAAACTCAAGGTGTTGGCAGGG - Intergenic
984699366 4:182808449-182808471 ACACATGCAGCGTCTTGGCACGG - Intergenic
984717688 4:182940812-182940834 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
984990943 4:185380369-185380391 CCAAAATCAAGGTGTTGGCAGGG + Intronic
986485279 5:8229751-8229773 CCAACTGCAGGCTCTGGGCAAGG + Intergenic
986660677 5:10057271-10057293 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
989456930 5:41654834-41654856 CCAAGAGCAAGGTGTTGGCAAGG + Intergenic
990167524 5:53011074-53011096 CCAAAATCAAGGTGTTGGCAGGG - Intronic
990719712 5:58680594-58680616 CCAAAGTCAGGGTGTTGGCAGGG + Intronic
991264309 5:64699198-64699220 CCAAATGCATGCTATTGGTAAGG + Intronic
991437307 5:66609995-66610017 CCAAAATCAGGGTGTTGGCAGGG + Intronic
992393088 5:76347289-76347311 CCAAAGGCATGGTCTGGAGAGGG + Intronic
992754637 5:79892756-79892778 CCAAAGTCAAGGTGTTGGCAGGG - Intergenic
994287188 5:97983216-97983238 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
997436455 5:133879230-133879252 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
997671170 5:135673771-135673793 CTAAATGACTGGACTTGGCAAGG - Intergenic
998967637 5:147557985-147558007 CAAAATGCAAGGTCTTAGAAAGG - Intergenic
999726783 5:154445042-154445064 CCAAGCGCAGGGTCTTGGCAGGG + Intergenic
999998695 5:157117167-157117189 AGAAGTACATGGTCTTGGCATGG - Intronic
1000212593 5:159121083-159121105 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1000244062 5:159434409-159434431 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1000436460 5:161216511-161216533 CCAACTTCATAGTCTTTGCAAGG - Intergenic
1001136924 5:169110389-169110411 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1003184524 6:3819553-3819575 CCTAGTGCGTGGTCTTGGGATGG + Intergenic
1003848155 6:10195415-10195437 CCACAGGCATGGGCTTGGGATGG + Intronic
1003946891 6:11084238-11084260 CCAAAAGCAAGGTATTGGCTGGG - Intergenic
1004923421 6:20397992-20398014 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1005446721 6:25931605-25931627 CCAAAATCAAGGTATTGGCAAGG + Intergenic
1005470004 6:26153905-26153927 CCAAATGCATGGGCTGGGAGAGG - Intergenic
1007857910 6:44877174-44877196 CCCAGTGCATGGGCTGGGCACGG + Intronic
1010149260 6:72711281-72711303 CCAAGATCATGGTGTTGGCAGGG - Intronic
1010361188 6:74996461-74996483 CCAAAATCAAGGTGTTGGCAAGG - Intergenic
1010602127 6:77842122-77842144 CCAAATTCATAGTCTTTTCAAGG + Intronic
1011541780 6:88438080-88438102 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1011591640 6:88975673-88975695 ACATATGCAAGGTGTTGGCAGGG + Intergenic
1013049536 6:106519131-106519153 CCACATGTTTGGGCTTGGCAGGG - Exonic
1013204337 6:107933246-107933268 CCAAAGTCATGATGTTGGCAGGG - Intronic
1014365941 6:120542009-120542031 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1015603962 6:134936961-134936983 TCAAATGTAGGGGCTTGGCAGGG + Intronic
1016442815 6:144101915-144101937 CCAAGAGCAAGGTGTTGGCATGG + Intergenic
1017468616 6:154717991-154718013 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1019117016 6:169773408-169773430 CCAAATGCAGGGTCCCGGGAGGG + Intronic
1019509348 7:1409616-1409638 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1020280392 7:6647274-6647296 CCAGCTGCATGGCCTTGGCCAGG - Intronic
1023032280 7:36100760-36100782 CTAAAAGCAAGGTGTTGGCAGGG + Intergenic
1023402199 7:39798389-39798411 CCAAGTACATGGTCTGGGCAGGG + Intergenic
1024026114 7:45411189-45411211 CCAAAATCATGGTGTTGGCAGGG + Intergenic
1024647421 7:51382271-51382293 CCAAGTACATGGTCTGGGCAGGG - Intergenic
1024954064 7:54897554-54897576 CCTAAGGCAAGGACTTGGCAAGG - Intergenic
1025051255 7:55736766-55736788 CCAAGTACATGGTCTGGGCAGGG - Intergenic
1025060021 7:55798021-55798043 CCGAGTACATGGTCTGGGCAGGG - Intronic
1025128217 7:56362442-56362464 CCAAGTACTTGGTCTGGGCAGGG - Intergenic
1026193644 7:68152465-68152487 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1027534102 7:79374474-79374496 CCAAAAGCAAGGTGTTGGCGGGG - Intronic
1030133317 7:106221503-106221525 CCAAAGATATGGTCTTGGCCAGG + Intergenic
1030936591 7:115592694-115592716 CCAAATTCAAGGTGATGGCAGGG + Intergenic
1031686789 7:124740072-124740094 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1031715573 7:125105075-125105097 GCAAATGGAAGGTCTTGCCATGG + Intergenic
1032052713 7:128658782-128658804 CCAAGTACATGGTCTGGGCAGGG + Intergenic
1032702297 7:134393018-134393040 CCAAAAGCATCATCTAGGCATGG + Intergenic
1033547376 7:142413674-142413696 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1034527412 7:151674296-151674318 CCAAAGTCAAGGTGTTGGCAGGG - Intronic
1035085023 7:156250988-156251010 ACAACTGCATGGGTTTGGCAGGG - Intergenic
1035540085 8:427609-427631 CCAAAATCAAGGGCTTGGCAGGG + Intronic
1035870463 8:3131943-3131965 CTAAATTCATGGTCTTAACAGGG + Intronic
1037491204 8:19398604-19398626 ACAAATGCATGGGCTATGCATGG + Intergenic
1038587168 8:28800352-28800374 CCAAATGAATGTACTTGGCCAGG + Intronic
1038892234 8:31738648-31738670 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1039130631 8:34260398-34260420 TCAAAACCATGGTCTTGTCATGG + Intergenic
1039340011 8:36637432-36637454 CCAAAATCAGGGTATTGGCAGGG - Intergenic
1039472374 8:37821500-37821522 CCCATTGCATGTGCTTGGCAGGG - Intronic
1040434429 8:47376379-47376401 CCAAAAGCAAGGTCCTGGCTGGG - Intronic
1040794508 8:51274163-51274185 CCAAAATCAAGGTGTTGGCAAGG + Intergenic
1041224020 8:55680546-55680568 CCAAAATCAAGGTGTTGGCAAGG - Intergenic
1041516179 8:58701011-58701033 CCAAAATCATGGTGTTGGCAGGG - Intergenic
1041880657 8:62746097-62746119 CTGAATTCAAGGTCTTGGCAGGG + Intronic
1042339291 8:67662062-67662084 CCAAAATCATGGTCTTAGGAGGG - Intronic
1042464916 8:69117771-69117793 CCAAAGTCAAGGTCTTGGCAGGG - Intergenic
1042985963 8:74583154-74583176 TGAAATGCATGGTCTAGGCTTGG + Intergenic
1043788212 8:84429169-84429191 ACAAAAGCATGGTGTTGGAATGG + Intronic
1044232862 8:89799058-89799080 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1044243180 8:89911043-89911065 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1045822695 8:106359383-106359405 CCAAATCAATGGTTTTGTCATGG - Intronic
1046124272 8:109884694-109884716 ACAAATTCAAGGTGTTGGCAAGG + Intergenic
1046194324 8:110839051-110839073 CCAAAATCAAGGTGTTGGCAGGG - Intergenic
1046538546 8:115548578-115548600 CCAAATGAATGTTGTTGGCCAGG - Intronic
1047619807 8:126594843-126594865 CCAAAACCAAGGTGTTGGCAAGG - Intergenic
1048562679 8:135558859-135558881 CCAAAGTCAAGGTGTTGGCAAGG + Intronic
1049595630 8:143482035-143482057 CCCACTGCAGGGTCTTGGCAGGG - Intronic
1049865807 8:144934658-144934680 CCCAAGTCAGGGTCTTGGCAGGG - Intronic
1050598358 9:7226575-7226597 GCATCTGCATGGTCCTGGCAAGG - Intergenic
1050662562 9:7898854-7898876 CTAAAATCATGGTGTTGGCAGGG - Intergenic
1051310632 9:15767227-15767249 CCAAAATCAAGGTGTTGGCAGGG + Intronic
1052354985 9:27494806-27494828 ACAAATGTATGTTCTTGGCAGGG - Intronic
1052823517 9:33158699-33158721 CCAAATGGGTGGTCTGGGCCAGG - Intronic
1055078462 9:72242222-72242244 CCAAATGCATGGTCTTGGCAGGG - Intronic
1055107371 9:72527006-72527028 CCAGACGCATGGTCTAGGTAGGG + Intronic
1055289167 9:74764544-74764566 CCAAAATCAAGGTGTTGGCAGGG - Intronic
1057855160 9:98595961-98595983 CAAGATGCATGGACTTGGCCAGG - Intronic
1058953297 9:109923450-109923472 GCACATGCATGGTGTTGGCAGGG + Intronic
1059062821 9:111051461-111051483 CCAAGTTCCTGGTGTTGGCAGGG + Intergenic
1059339993 9:113592247-113592269 CCAATTGCATTTTCTTAGCAAGG + Intronic
1186027940 X:5334348-5334370 CTGAAAGCATGGTGTTGGCATGG - Intergenic
1186091275 X:6051629-6051651 CCAAAATCAAGGTGTTGGCATGG - Intronic
1187311152 X:18144243-18144265 CCAAATGTATTATCTTGTCAAGG + Intergenic
1188571632 X:31592895-31592917 CCAAATACATGATCGTGGGAGGG + Intronic
1190106708 X:47566549-47566571 CCAAATGCATGTTTATGGCTGGG + Intronic
1190790412 X:53694773-53694795 CCAAATGATTGGTTTAGGCATGG - Intergenic
1190870614 X:54421783-54421805 CCAAAATCAAGGTGTTGGCAGGG + Intergenic
1192144617 X:68673319-68673341 CAAAAAGCATGTACTTGGCAAGG - Intronic
1194359303 X:92929226-92929248 CTAAAATCAAGGTCTTGGCATGG + Intergenic
1194454991 X:94092566-94092588 CCAAAATCATGGTGTTGGCAGGG - Intergenic
1197681189 X:129387034-129387056 CCAAAATCAAGGTCTTGGCAGGG - Intergenic
1198651768 X:138870961-138870983 CCAAAATTAAGGTCTTGGCAGGG - Intronic
1199722392 X:150551264-150551286 CCAAAATCATGGTGATGGCAGGG + Intergenic
1200667499 Y:6045061-6045083 CTAAAATCAAGGTCTTGGCATGG + Intergenic