ID: 1055079488

View in Genome Browser
Species Human (GRCh38)
Location 9:72255199-72255221
Sequence ATTTGCATGTAATTGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 29, 2: 133, 3: 222, 4: 493}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055079488_1055079494 4 Left 1055079488 9:72255199-72255221 CCTGCTTTCAATTACATGCAAAT 0: 1
1: 29
2: 133
3: 222
4: 493
Right 1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG No data
1055079488_1055079495 5 Left 1055079488 9:72255199-72255221 CCTGCTTTCAATTACATGCAAAT 0: 1
1: 29
2: 133
3: 222
4: 493
Right 1055079495 9:72255227-72255249 GGTGGGTGGATGCAAATTGAGGG No data
1055079488_1055079493 -9 Left 1055079488 9:72255199-72255221 CCTGCTTTCAATTACATGCAAAT 0: 1
1: 29
2: 133
3: 222
4: 493
Right 1055079493 9:72255213-72255235 CATGCAAATTAACGGGTGGGTGG No data
1055079488_1055079496 6 Left 1055079488 9:72255199-72255221 CCTGCTTTCAATTACATGCAAAT 0: 1
1: 29
2: 133
3: 222
4: 493
Right 1055079496 9:72255228-72255250 GTGGGTGGATGCAAATTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055079488 Original CRISPR ATTTGCATGTAATTGAAAGC AGG (reversed) Intronic
900688620 1:3965730-3965752 ATTTGCATGTCATTAAAAGCAGG + Intergenic
900737097 1:4305816-4305838 ATTTGCATGTAACTAACAGTGGG - Intergenic
901125299 1:6924740-6924762 TTTTGCATCTTATTGGAAGCCGG + Intronic
902153397 1:14463078-14463100 ATTTGCATGTAATTAAAAGTGGG - Intergenic
902154573 1:14474197-14474219 ATTTGCATGTACTAGAAAATAGG - Intergenic
902259943 1:15217347-15217369 TTTTGCACATAATTGAAAGTGGG + Intronic
902260124 1:15218861-15218883 ATTTGCATGTGACTAAAAGTGGG + Intronic
902273036 1:15318341-15318363 ATTTACATTTAAATTAAAGCCGG + Intronic
902714077 1:18260555-18260577 ATTTGCATGTAATTGAAAGTGGG - Intronic
902714247 1:18261551-18261573 ATTTGCATGTAATTAAAAGTGGG + Intronic
902749066 1:18494082-18494104 ATTTGCATGTAATTAAAAGTGGG - Intergenic
902959904 1:19955894-19955916 ATTAGCATGTCATTCAAAGTGGG + Intergenic
903162699 1:21500720-21500742 ATTTGCATCTAACAGGAAGCGGG + Intergenic
903517364 1:23920537-23920559 TTTTGCATGTAATTGCTAGGTGG - Intergenic
903824414 1:26132785-26132807 ATTTGCATATAATTAAAAGTGGG + Intergenic
904348555 1:29890111-29890133 ATCTGCATGTCATTAAAAGTGGG + Intergenic
904407840 1:30305042-30305064 ATTTGCATGTAATTAAAAGTGGG + Intergenic
904455986 1:30648438-30648460 ATTTGCATATAATTAAAATTGGG - Intergenic
904718354 1:32486507-32486529 ATTTGCATGTAACTAAAAGTGGG - Exonic
905039034 1:34937950-34937972 ATTTGCATATAATTAAAAGTAGG + Intergenic
905764945 1:40592526-40592548 ATTTGTGTGTAATTGAAAGTAGG + Intergenic
905869596 1:41395435-41395457 ATTTGCATGTTAATGAAGCCCGG - Intergenic
906217286 1:44050484-44050506 ATTTGCATGTACTTAAAAGTGGG + Intergenic
906218877 1:44061609-44061631 ATTTGCATGTAATTAAAAATGGG + Intergenic
906234418 1:44195897-44195919 ATTTGCATGTAATCGAAAGTGGG + Intergenic
906425080 1:45704963-45704985 ATTTGCACATAATTAAAAGTAGG + Intronic
906499877 1:46333847-46333869 ATTTGCATCTAATTAAAAGTGGG + Intergenic
906578279 1:46910859-46910881 ATCTGCATGCAATTAAAAGTGGG - Intergenic
906978990 1:50608107-50608129 ATTTGCATGTAATTAAAAGCAGG - Intronic
907002296 1:50873688-50873710 ATTTGCATGTAATTAAAAGTGGG + Intronic
907026414 1:51124608-51124630 ATTTGCATGTAATTGAATGTGGG - Intronic
907111294 1:51928759-51928781 ATATTCATGAAATTGAAAGAAGG - Intronic
907652644 1:56310457-56310479 ATCTGCATGCAATTAAAAGTGGG - Intergenic
907730064 1:57057547-57057569 ATTTGCATGTCACAGAAGGCTGG - Intronic
908782428 1:67703351-67703373 ATGTGCATGTTATTGGTAGCAGG - Exonic
908934281 1:69355938-69355960 ATTTGTATATAATTAAAAGTAGG - Intergenic
910035462 1:82782702-82782724 ATTTGCATGTAATTAAAAGTAGG + Intergenic
910328772 1:86043930-86043952 ATTTGAATGTGATAGAAACCTGG - Intronic
910521586 1:88127931-88127953 AGTTGCATGCCCTTGAAAGCAGG + Intergenic
911409804 1:97488842-97488864 ATTTGGATGTAATCAAAAGTGGG + Intronic
911732331 1:101304163-101304185 ATTTGCATGTAATTAAAAGTGGG + Intergenic
911775475 1:101805967-101805989 ATTTGTTTGTACTTGAAAACTGG - Intronic
911937956 1:104004715-104004737 ATTTGCATATAATTAAAAGTGGG + Intergenic
911959174 1:104277888-104277910 ATTTGCATGTAATTGGCACTAGG - Intergenic
912043829 1:105427834-105427856 TTTTGCATGTAATTGAAAGTAGG - Intergenic
912971401 1:114287046-114287068 CTTTGCATATAATTGAAAGTGGG - Intergenic
913658184 1:120981806-120981828 ATTGGCATGTAATTAAAAGTGGG - Intergenic
914009540 1:143764875-143764897 ATTGGCATGTAATTAAAAGTGGG - Intergenic
914415545 1:147477986-147478008 TTTTGCATGTAATTTCAAGAAGG - Intergenic
914648165 1:149673550-149673572 ATTGGCATGTAATTAAAAGTGGG - Intergenic
914938366 1:152000574-152000596 ATCTGCATGCAATTAAAAGTGGG - Intergenic
914982362 1:152425945-152425967 ATTAGCATGTCATTAAAAGTGGG + Intergenic
915259315 1:154664948-154664970 ATTTGCATGTAATTAAAAGTGGG + Intergenic
916005800 1:160658939-160658961 ATTTGCATATAATTAGAAGTGGG - Intergenic
916410519 1:164542654-164542676 ATTTGCATGTAATAACAAACAGG + Intergenic
916648147 1:166809237-166809259 ATTTGCATATAATTGAAAGTAGG + Intergenic
917205494 1:172566656-172566678 ATTTGCATATAATTAAAAGTGGG - Intronic
917613933 1:176717447-176717469 ATTAGCATATAATTAAAAGTGGG + Intronic
918087847 1:181260669-181260691 ATTTGCAGGGGATTGTAAGCAGG + Intergenic
918420656 1:184361321-184361343 ATTTGCATGTAATTAAAAGTGGG - Intergenic
918682438 1:187372086-187372108 ATTTGCATGTAATTGAAAGTGGG + Intergenic
918682497 1:187372730-187372752 ATTTGCATGTAGTTGAAAATGGG - Intergenic
918794307 1:188873262-188873284 ACTTGCATGTCATTAAAAGTGGG + Intergenic
919180590 1:194076302-194076324 ATCTGCATGTAATTAAAAGCAGG + Intergenic
920063419 1:203245846-203245868 ATTTGCATATAATTATAAGTGGG - Intronic
920606758 1:207396431-207396453 ATTTGCATATAATTAAAAATAGG - Intergenic
921387250 1:214582567-214582589 GTTTGCATGTAAATTAAAGTGGG - Intergenic
921525793 1:216216366-216216388 ATTTTGAGGTAATGGAAAGCAGG - Intronic
921640809 1:217551237-217551259 ATTTGCATCAAATAGAATGCCGG - Intronic
921753835 1:218829255-218829277 ATTTGCATATAAATAAAAGTAGG - Intergenic
921802402 1:219416588-219416610 ATTTGCATACAATTAAAAGTGGG - Intergenic
922221448 1:223611441-223611463 ATTTGCATATAATTAAAAGTTGG + Intronic
922459958 1:225808431-225808453 ATCTGCATGTAACTAAAAGTGGG - Intergenic
922538498 1:226401408-226401430 ATTTGCATATAATTAAAAGTGGG - Intronic
923202465 1:231725519-231725541 ATTTGCCTGTAATTGAAAGTGGG + Intronic
923203072 1:231731347-231731369 ATTTGCATGTAATTAAAAGTAGG - Intronic
924001312 1:239555659-239555681 ATCTGCATGCAATTAAAAGTAGG + Intronic
924848180 1:247794267-247794289 ATTTGCATGTAATTGGAAGTGGG + Intergenic
1063072054 10:2676474-2676496 TTCTGCATCTAATTTAAAGCTGG + Intergenic
1063279926 10:4616759-4616781 ATTTTCATGCAATTTAAAGGCGG - Intergenic
1063516170 10:6698012-6698034 ATTTGCATGGAAGTGAAATAAGG - Intergenic
1063746638 10:8891144-8891166 ATTTGCATATGATTAAAAGTAGG - Intergenic
1063925775 10:10975919-10975941 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1063965929 10:11345799-11345821 ATTTGCATGTGATTGAAAGTGGG - Intergenic
1063966821 10:11352486-11352508 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1064647357 10:17473108-17473130 ATTTGCATGTAACTGAAAGTGGG + Intergenic
1064689136 10:17895914-17895936 ATTTGCATGTAATTAAAAGTGGG - Intronic
1065618253 10:27551097-27551119 ATTTGCATATGATTTAAAGTTGG + Intergenic
1066371819 10:34824023-34824045 AGTTTTATGTAATTGAAATCGGG + Intergenic
1066581186 10:36884248-36884270 ATATGAATGTAATTCAAAGTAGG + Intergenic
1067261951 10:44700498-44700520 ATTTGTATGAAATTAAAGGCAGG + Intergenic
1068264985 10:54635480-54635502 ATTTCCATGTAATAGAACTCTGG - Intronic
1068378613 10:56216961-56216983 ATTTGCATATAATTAAAAGTGGG + Intergenic
1068483412 10:57624977-57624999 CTTTGAAAGTAATGGAAAGCAGG - Intergenic
1068530841 10:58184855-58184877 CATTGTATGTACTTGAAAGCAGG + Intergenic
1068657266 10:59588558-59588580 ATTTGTGTGTAATTGAAAGTGGG - Intergenic
1068691504 10:59920445-59920467 ATTTGCATATAATTAAAAGTGGG - Intergenic
1069048180 10:63764873-63764895 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1069265784 10:66455628-66455650 ACATGCATGTAATTAAAAGTGGG + Intronic
1069274595 10:66573683-66573705 GTTTTCTTTTAATTGAAAGCAGG - Intronic
1070450753 10:76554750-76554772 AGTTGCATGTAAGTGAGATCTGG + Intronic
1070501886 10:77080243-77080265 ATCTGCATGCAATTAAAAGTAGG + Intronic
1071946552 10:90652293-90652315 ATTTGCATATAATTAAAAGTGGG + Intergenic
1071970693 10:90903412-90903434 ATTTTCATGTTATAGAAAGGAGG + Intronic
1072264288 10:93712697-93712719 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1072397225 10:95057032-95057054 ATATGCATGCAATTAAAAGTGGG - Intronic
1072888954 10:99304332-99304354 ATCTGCATGCAATTAAAAGTGGG + Intergenic
1073127230 10:101158918-101158940 ATTTGCATATAGTTAAAAGCGGG + Intergenic
1073793325 10:106961797-106961819 ATTTGCAAGTTATTAAAAGTGGG + Intronic
1073857323 10:107692790-107692812 ATTTGCATGTTATGGAGAGGTGG + Intergenic
1073936115 10:108634379-108634401 ATTAGCATGTTATTAAAAGTGGG - Intergenic
1074390760 10:113056364-113056386 ATTTGAATCTAATTGGAAGTGGG + Intronic
1074575806 10:114668083-114668105 GGTTGCATGAAATTGAAAGGGGG + Intronic
1074834456 10:117275725-117275747 ATTTGCTTATATTTGATAGCTGG - Intronic
1074870558 10:117572489-117572511 ATTTAAATGGAATTGAAAGCAGG - Intergenic
1074963812 10:118471361-118471383 ATTTGCATGCAGTTGATATCAGG - Intergenic
1074992552 10:118722964-118722986 ATTTGCATATAATTAAAAGTAGG + Intronic
1075363633 10:121862925-121862947 ATTTGCATGCAATTAAAGGGGGG + Intronic
1076200552 10:128554414-128554436 ACTTGCATGTAACTGAAAGTAGG - Intergenic
1077983105 11:7321735-7321757 ATTTGTATGTAATTGGAAGTGGG - Intronic
1078126366 11:8568048-8568070 ATGTGCATAAAATTGAAAGATGG + Intronic
1079064022 11:17274247-17274269 ATTTGCATATACTTAAAAGTGGG + Intronic
1080650289 11:34217039-34217061 ATTTGCATATAATTAAAAGTGGG + Intronic
1080900875 11:36489760-36489782 GTTTGCATGTTATTGAGAACAGG + Exonic
1081178418 11:39957812-39957834 ATTTGCATGTATTACAAAGTAGG - Intergenic
1081338778 11:41902190-41902212 ATTTGCATGTAATTAGAAATAGG + Intergenic
1081842715 11:46214902-46214924 ATTTGTATATAATTAAAAGTGGG + Intergenic
1082827871 11:57594013-57594035 ATCTGCATGTAATGGAAAGTGGG + Intergenic
1082898516 11:58219557-58219579 ATTAGCATTAAATTGAAAGTGGG + Intergenic
1083543487 11:63531438-63531460 ATTAGCATATAATTAAAAGTGGG - Intergenic
1083699082 11:64462688-64462710 ATCTGCATGCAATTAAAAGTAGG - Intergenic
1083700339 11:64473252-64473274 ATTTGCATGCAATTGAAATTGGG + Intergenic
1083817805 11:65146801-65146823 ATTTGCATATAATTAAAAGTGGG - Intergenic
1083982420 11:66183804-66183826 ATTTGCATGTAATTAAGAGTGGG - Intronic
1084186153 11:67472954-67472976 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1084240795 11:67818349-67818371 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1084406230 11:68975233-68975255 ACTTGCATATAATTGAAAGTGGG + Intergenic
1084656292 11:70521339-70521361 ATTTGCATGTCATTGCAAACTGG - Intronic
1084731832 11:71078791-71078813 ATTTGCATGTAATTAAAAGTGGG + Intronic
1084831644 11:71774363-71774385 ATCTGCATGTAATTAAAAGTGGG + Intergenic
1085308070 11:75499710-75499732 ACTTCCCTGTAATTGAGAGCTGG + Intronic
1085648536 11:78245518-78245540 ATTTCCAGATAAATGAAAGCTGG + Intronic
1086069798 11:82788060-82788082 ATTTGCATGAAAATAGAAGCGGG - Intergenic
1086228329 11:84539228-84539250 ATTAACATGTATTTGAAACCTGG - Intronic
1086427630 11:86702439-86702461 ATTTGCATGTAGTTAAAAGTGGG - Intergenic
1086481061 11:87239722-87239744 ATTTTCTTTTTATTGAAAGCAGG - Intronic
1086554420 11:88091899-88091921 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1087063627 11:94007720-94007742 TTTTGCATGTAATGGAAAACTGG + Intergenic
1087134193 11:94698459-94698481 ACTTGCATGTCATGGAATGCAGG + Intergenic
1087636646 11:100709502-100709524 AATGGCATGTAATTTAAAACTGG + Intronic
1088181468 11:107117429-107117451 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1088380189 11:109184341-109184363 ATTTACATGTAATTGAAAGTGGG - Intergenic
1088566153 11:111175225-111175247 ATCTACATGTAATTAAAAGTCGG - Intergenic
1088792044 11:113234877-113234899 ATATGCATAGAATTGAAAGTCGG - Intronic
1088891375 11:114047384-114047406 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1089221631 11:116876848-116876870 CTTTGCATGTGATTGTAATCAGG - Intronic
1089799393 11:121012856-121012878 ATATCCATAGAATTGAAAGCAGG + Intergenic
1089824755 11:121265090-121265112 ATCTGAATGTTATTAAAAGCTGG + Intergenic
1090153340 11:124408872-124408894 ATTTGCATGCAATTAGAAGTAGG + Intergenic
1090712425 11:129399722-129399744 ATTTACATATAATTAAAAGGGGG - Intronic
1090713837 11:129412573-129412595 ATTTGCATATAATTAAAAGTGGG - Intronic
1091467094 12:694250-694272 ATTTGCATATAATTAAAAGTGGG + Intergenic
1092135121 12:6141983-6142005 ACTTGCAAGTAATTGAAAGTGGG - Intergenic
1093052073 12:14515736-14515758 AAGTGCATGTACTTGAAAGTAGG - Intronic
1093053489 12:14531938-14531960 AAGTGCATGTATTTGAAAGTAGG + Intronic
1093227546 12:16503827-16503849 ATTTGCATTTAATTAAAAGTGGG + Intronic
1093627821 12:21371077-21371099 ATCTGCATGTAGTTAAAAGTGGG - Intronic
1094581440 12:31737421-31737443 ATTTGCATGTAATTAGAAGTGGG - Intergenic
1097878471 12:64665690-64665712 ATTTGCATGTAATTAAAAATGGG + Intronic
1098240245 12:68459755-68459777 ATTTGCATTTAAGTGAGGGCTGG - Intergenic
1098279111 12:68845276-68845298 TCTTACATATAATTGAAAGCTGG - Exonic
1098898910 12:76092650-76092672 ATTTACATATAATTAAAAGTGGG + Intergenic
1099023288 12:77433311-77433333 AGTTTCATGTAATAAAAAGCTGG + Intergenic
1099055517 12:77835016-77835038 ATTTTCATGTAAAGGAAATCTGG + Intronic
1099178959 12:79455892-79455914 ATTTTCAGATAATTGAAAGGTGG - Intergenic
1099419618 12:82440711-82440733 TTTAGTATGTTATTGAAAGCAGG - Intronic
1099529690 12:83762738-83762760 ATCTGCATGCAATTAAAAGTGGG + Intergenic
1099562492 12:84195393-84195415 ATTTGCATGTAACTGAAAGTGGG + Intergenic
1099615951 12:84936351-84936373 ATTTCAATGTAATTGAAACCAGG - Intergenic
1099839129 12:87943945-87943967 ATTTGCATGTAACTGAAAGTAGG - Intergenic
1099869757 12:88332079-88332101 GTTTGCATATAATTAAAAGTGGG - Intergenic
1100548960 12:95628793-95628815 ATTTGCATATAATTAAAAGTGGG + Intergenic
1100965102 12:100004605-100004627 ATAAGCATGATATTGAAAGCTGG + Intergenic
1101354300 12:103962700-103962722 ATTTGCATATAATTAGAAGTGGG + Intronic
1101397538 12:104361666-104361688 ATTTGCATGTAATAAAAAGTGGG + Intergenic
1101530463 12:105568772-105568794 ACTTGCATATAATTAAAAGTGGG - Intergenic
1102433961 12:112905784-112905806 ATTTGCACGTATTTAAAAGTGGG - Intergenic
1102448992 12:113026527-113026549 ATTTGCATATAATTAAAAATGGG - Intergenic
1102666376 12:114577542-114577564 ATCTGCATGTAATTAAACGTAGG - Intergenic
1102816168 12:115868191-115868213 AATTGCATATAATTAAAAACGGG + Intergenic
1102883770 12:116506545-116506567 ATCTGCATGCAATTTAAAGTAGG + Intergenic
1102921913 12:116797806-116797828 ATCTACATGTAATTAAAAGTAGG - Intronic
1103233900 12:119355752-119355774 ATTTGCATATAATTAAAAATGGG - Intronic
1103460690 12:121102398-121102420 ATTTGCATATAATTAAAAGTAGG - Intergenic
1103879000 12:124151666-124151688 ATTTGCATGTTATTGAAAGTGGG - Intronic
1104195612 12:126534509-126534531 ATTTGCATATAATTGAAAGTAGG - Intergenic
1104434293 12:128743435-128743457 ATTTGCACATAATTAAAAGTAGG + Intergenic
1104561144 12:129845908-129845930 ATTTGCATGTAATTAAAAGTGGG - Intronic
1104621124 12:130313559-130313581 ATTTTCATGTAATTAAAAGTGGG + Intergenic
1104646533 12:130501638-130501660 ATTTGCATGTAATTAAAACCTGG + Intronic
1104756043 12:131269864-131269886 ATTTGCATGTAATTAAGAGGGGG - Intergenic
1105293504 13:19069906-19069928 CTTTGCATGTGACTGAAAGTTGG - Intergenic
1105421786 13:20258953-20258975 ATTTGCATGAAATAAAAAGAAGG - Intergenic
1106507136 13:30380919-30380941 ATTTGCTTGTAATTGAAAGTTGG - Intergenic
1106598044 13:31163211-31163233 ATTTACATGTAATGTAAACCTGG - Intergenic
1106762012 13:32876664-32876686 ATTTACTTGTAATGGACAGCAGG + Intergenic
1107022636 13:35767064-35767086 ATTTGCATGTGACTGATGGCTGG + Intergenic
1107921592 13:45213790-45213812 ATTTGCACTTACTTGAAACCTGG + Intronic
1108377720 13:49828862-49828884 ATTTGCATATACTTAAAAGTGGG + Intergenic
1108773913 13:53739910-53739932 ATCTGCATGAAATTAAAAGTGGG + Intergenic
1109192975 13:59347109-59347131 ATTTACATGTAATTACAAGTAGG - Intergenic
1109419014 13:62085421-62085443 ATCTGCATGTTATTAAAAGTGGG + Intergenic
1109505242 13:63292156-63292178 ATTTACATGTATTTCAAAGAGGG + Intergenic
1111208319 13:85041589-85041611 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1111450505 13:88408894-88408916 ATTTGCATGTAATTAAAAGTAGG - Intergenic
1111703075 13:91715022-91715044 ATCTGCATGTAATTAGAAGTAGG - Intronic
1112022128 13:95380691-95380713 ATTTGCATATAGTCGAAAGTGGG - Intergenic
1112582480 13:100688408-100688430 ATTTGCATGTGCTTGAAAGTGGG - Intergenic
1112583568 13:100697140-100697162 CTTTGCATGTAATTGAAAGTGGG - Intergenic
1112591105 13:100763651-100763673 ATTTGCACGTAATTATAAGTGGG + Intergenic
1112751478 13:102588302-102588324 ATTTGCATGCAATTGTAAGTGGG - Intergenic
1112816361 13:103278369-103278391 ATTTGCATATAATTAAAAGTTGG + Intergenic
1112966086 13:105196027-105196049 TTTTGCAGGTAATTGAAGGAGGG - Intergenic
1113592150 13:111508514-111508536 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1114850631 14:26378812-26378834 ATTTGCATGTAATTGAAAGTAGG - Intergenic
1115139330 14:30151128-30151150 ATTTGCATGTAATTGAAATTTGG + Intronic
1116145935 14:41069207-41069229 ATTTGCATGCAATTAAAAGGGGG - Intergenic
1116259346 14:42602955-42602977 ATATGCATGTAATTAATAGTAGG - Intergenic
1116628472 14:47297791-47297813 AAATGCATGTAATTTAAAGCAGG + Intronic
1117665109 14:58048421-58048443 ATTTGGATGTAATTAATAGCAGG + Intronic
1117880642 14:60310094-60310116 ATTTGCATATAATTAAAAGTGGG - Intergenic
1118374800 14:65167369-65167391 ATTTGCATACAATTCAGAGCAGG + Intergenic
1118798976 14:69171882-69171904 ATCTGCATGCAATTAAAAGTAGG + Intergenic
1119032699 14:71204976-71204998 ATTTGCATATTATTAAAAGTGGG - Intergenic
1119122822 14:72095788-72095810 ATTTGCATGACATTGAAATACGG - Intronic
1119381244 14:74230174-74230196 ATTTGCATGCAATTTAAAGTGGG - Intergenic
1120036727 14:79706351-79706373 ATTTGCATATATTTGAAAGTGGG - Intronic
1120060362 14:79975584-79975606 ATTTGCATATAATTAAAAGTGGG - Intergenic
1120197331 14:81499272-81499294 ATCTACATGTAAATGAAAGTTGG - Intronic
1120327443 14:83049254-83049276 ATTTGCATGTAAATAAAAGTGGG + Intergenic
1120503667 14:85327360-85327382 ATTTGCAGGTATTTGATAGCCGG + Intergenic
1120813738 14:88831330-88831352 ATTTGCATGTAATTGAAAGTGGG + Intronic
1120848240 14:89145183-89145205 GTTTGCATGTACTTGGCAGCAGG + Intronic
1121836885 14:97100379-97100401 ATCTACATGTAATTAAAAGTAGG - Intergenic
1122002697 14:98674843-98674865 ATTTGCATATAACTAAAAGTGGG - Intergenic
1122850745 14:104528920-104528942 ATCTGCATGCAATTAAAAGTGGG + Intronic
1122962347 14:105100989-105101011 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1123829614 15:24121057-24121079 ATTTACATGTAATTGAAAGTGGG - Intergenic
1123835199 15:24182950-24182972 ATTTGCATATAATTAAAAGTGGG - Intergenic
1123849956 15:24344306-24344328 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1123859611 15:24450721-24450743 ATTTACATGTAATTGAAAGTGGG - Intergenic
1123870926 15:24571845-24571867 ATTTGCATATAATTAAAAGTGGG - Intergenic
1124016707 15:25883094-25883116 ATTTGCCTGTGATTAAAAGTGGG + Intergenic
1125260446 15:37818442-37818464 TATTTCATGTAAATGAAAGCAGG + Intergenic
1125558204 15:40603836-40603858 ATTTGCATATAATTAAAAATGGG - Intronic
1125757985 15:42078049-42078071 ATTTGCATGTAATTAAAAATGGG + Intronic
1126425349 15:48521837-48521859 ATATGCTTGTTATTTAAAGCAGG + Intronic
1127153455 15:56103874-56103896 TTATGAATGTTATTGAAAGCAGG - Intronic
1127222959 15:56899642-56899664 AATTGCATGTATTTGTAAGACGG + Intronic
1127581251 15:60341027-60341049 GTTTCCATGTAATTGACACCTGG - Intergenic
1129147967 15:73666459-73666481 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1129807492 15:78475911-78475933 ATTTTCATGTCTTTGAAATCAGG - Intronic
1129820134 15:78595100-78595122 ATTTGCATTTAATCGTAGGCAGG + Exonic
1129950499 15:79584905-79584927 GTTAGCATGTAATTCAAAGAGGG + Intergenic
1130078509 15:80710585-80710607 TTTTGGATGTATTTGAAAGGCGG + Intronic
1130324531 15:82869032-82869054 ATTTGCATGTAATTAAAAGTAGG + Intronic
1131192015 15:90324480-90324502 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1131692676 15:94844469-94844491 AATTGCTTGGAATTTAAAGCTGG + Intergenic
1131790925 15:95964859-95964881 ATTTGCATATAATTAAAATTAGG + Intergenic
1132479008 16:156845-156867 ATTTGCATATAATGAAAAGTGGG - Intronic
1132875956 16:2137321-2137343 ATTTGACTGCAATTAAAAGCTGG - Intergenic
1133165435 16:3943688-3943710 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1133447874 16:5877737-5877759 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1133498756 16:6345354-6345376 ATTTCCATGTAATTAAAAGTGGG - Intronic
1133549306 16:6838488-6838510 ATTTGCATGCAATTAAAAGTGGG + Intronic
1133716743 16:8457484-8457506 ATTTGCATATAATTAGAAGTAGG + Intergenic
1133724365 16:8523628-8523650 ATTTGCATGTAATTAAAATTGGG - Intergenic
1134505003 16:14797972-14797994 ATATGCAACTAATTGAAAGCGGG + Intronic
1134575571 16:15330937-15330959 ATATGCAACTAATTGAAAGCGGG - Intergenic
1134726874 16:16425563-16425585 ATATGCAACTAATTGAAAGCGGG + Intergenic
1134742355 16:16559321-16559343 ATTTACAGGTGATTTAAAGCAGG - Intergenic
1134749970 16:16618165-16618187 ATTTGCATATCATTAAAAGTGGG - Intergenic
1134925208 16:18153138-18153160 ATTTACAGGTGATTTAAAGCAGG + Intergenic
1134940560 16:18286300-18286322 ATATGCAACTAATTGAAAGCGGG - Intergenic
1134995506 16:18735450-18735472 ATTTGCATATCATTAAAAGTGGG + Intergenic
1135355902 16:21768789-21768811 ATCTGCATATAATTAAAAGCAGG - Intergenic
1135416590 16:22273235-22273257 ATATGCATGCAATTAAAAGTAGG - Intronic
1135418197 16:22285316-22285338 ATTTTCTTGTAATTTACAGCAGG + Exonic
1135454392 16:22584928-22584950 ATCTGCATATAATTAAAAGCAGG - Intergenic
1135491377 16:22912691-22912713 ATTTGCATGTAATTAGAAGTGGG - Intronic
1135534510 16:23282800-23282822 ATTTGTATGTAATTAAAAGTAGG + Intronic
1135536488 16:23298425-23298447 ATTAGCATGTCATTAAAAGTGGG - Intronic
1135783432 16:25326500-25326522 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1135794217 16:25425904-25425926 ATTTGCATGTAATTAAAAATGGG + Intergenic
1135842985 16:25893579-25893601 ATTTGCATGTGGCTCAAAGCTGG - Intronic
1135904584 16:26499475-26499497 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1135949310 16:26898386-26898408 ATTTGCATGTAATTAAAAATGGG + Intergenic
1135980606 16:27143977-27143999 ATTTGCATTTAATTAAAAGTGGG - Intergenic
1136054237 16:27676309-27676331 ATGAACATGTAATTGAAAACTGG - Intronic
1136614245 16:31386886-31386908 ATTTGCATGTAATTAAAAGTCGG + Intergenic
1136646921 16:31628773-31628795 GTTTGCATGTAATGAAAAGTGGG + Intergenic
1136658261 16:31727501-31727523 GTTTGCATGTAATGAAAAGTGGG - Intronic
1136689378 16:32017940-32017962 ATTTGCATACAATTAAAAGTGGG + Intergenic
1136789970 16:32961482-32961504 ATTTGCATACAATTAAAAGTGGG + Intergenic
1136879842 16:33892454-33892476 ATTTGCATACAATTAAAAGTGGG - Intergenic
1137405769 16:48188092-48188114 ATCTACATGTAATTAAAAGTAGG + Intronic
1137846822 16:51698022-51698044 ATTTTCATGTAATTAACAGCAGG - Intergenic
1138777429 16:59740887-59740909 ATTTGCATAAAATTGAAAGTGGG - Intronic
1138800968 16:60029196-60029218 ATTTGCATGTTATAGAAACAGGG + Intergenic
1138850812 16:60627441-60627463 ATTTGCGTACAATTAAAAGCGGG - Intergenic
1138859292 16:60735935-60735957 ATTTGCATGCAATTAAAAGTGGG + Intergenic
1138977537 16:62226036-62226058 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1139102896 16:63789585-63789607 GTTTACATGTACTTGAAAGTGGG - Intergenic
1139509994 16:67422106-67422128 ATTTGCTTGTATTTGAAATGGGG + Intergenic
1139681753 16:68570454-68570476 ATTTGCATGTAATTAAAAATGGG - Intronic
1140020851 16:71237329-71237351 ATTTGCATATAATTTACAGTGGG - Intergenic
1140300590 16:73753503-73753525 ATTTTCATGTAATTAAAAGTGGG + Intergenic
1140339808 16:74146501-74146523 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1140579175 16:76208521-76208543 ATTTGCATGTAATTGGAACCTGG + Intergenic
1140757344 16:78079679-78079701 ATCTGCATGCAATTAAAAGTAGG + Intergenic
1140838753 16:78819505-78819527 ATTTGCATATAATTAAAAATGGG + Intronic
1141410948 16:83832742-83832764 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1141847325 16:86619663-86619685 ATCTGCATGCAATTAAAAGTAGG + Intergenic
1142158010 16:88541528-88541550 ATTTGCATGTAATTGAAGAGGGG - Intergenic
1142162616 16:88566456-88566478 ATCTGCATGTAATTAAAAGTGGG + Intergenic
1142294300 16:89210328-89210350 ATTTGCATATAATTAAAAGTGGG + Intergenic
1203092173 16_KI270728v1_random:1222945-1222967 ATTTGCATACAATTAAAAGTGGG + Intergenic
1143368608 17:6424382-6424404 ATCTACATGTAATTAAAAGTGGG + Exonic
1143437823 17:6942272-6942294 ATTTGCATATAATTAGAAGTGGG + Intronic
1143533410 17:7520246-7520268 AGTTGCATTTAAATGAAAGAAGG - Intergenic
1144138805 17:12325433-12325455 CTTTGTATGTATATGAAAGCTGG - Intergenic
1144281093 17:13727260-13727282 ATTTGCATGTAAATGAAAGTGGG - Intergenic
1144413563 17:15024159-15024181 ATGTACATGTAATTAAAAGTGGG - Intergenic
1144424863 17:15132312-15132334 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1144819788 17:18064153-18064175 ATGTCCAAGGAATTGAAAGCAGG - Intronic
1145897013 17:28464941-28464963 ATTTGCATGTTATGCAAAACAGG + Intronic
1146087979 17:29847903-29847925 ATTTACATGTAATTGAAAGTGGG + Intronic
1146658311 17:34648346-34648368 ATTTGCATATAATTAATAGTGGG - Intergenic
1147152224 17:38524085-38524107 ATTTGCATACAATTAAAAGTGGG + Intergenic
1147431635 17:40375018-40375040 ATTTGCATATAACTAAAAGTGGG - Intergenic
1147445463 17:40472605-40472627 ATTTGCATGTGTTTAAAAGTGGG - Intergenic
1148057284 17:44807784-44807806 AATTGCAGCAAATTGAAAGCAGG + Intronic
1148968383 17:51457233-51457255 ATTTGCATGAAGTTCAAAGGGGG + Intergenic
1149270741 17:54974856-54974878 ATTTGCATATAATTAAAAGCGGG - Intronic
1149895779 17:60427233-60427255 ATTTGCAAGTAATTAAAAGCGGG - Intronic
1150013083 17:61524610-61524632 ATTTGCATATAATTAAAAAGTGG + Intergenic
1150161726 17:62903691-62903713 ATTTGTATGTGATTAAAAGTTGG + Intergenic
1150637887 17:66928986-66929008 ATTTGCATGTAATTAAAAGTAGG - Intergenic
1150765499 17:67998745-67998767 ATTTGAATGTAATGGTAAGAAGG - Intergenic
1151077712 17:71293349-71293371 ATTTGCACATAATTAAAAGTGGG + Intergenic
1151463727 17:74271351-74271373 ATTTGCATGTAATTAAAAATGGG - Intergenic
1151775146 17:76196020-76196042 ATTTGCACATAATTAAAAGTGGG + Intronic
1152009605 17:77703893-77703915 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1152044484 17:77927038-77927060 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1152292264 17:79446681-79446703 ATTTGCATGCAATTAAAAGTGGG + Intronic
1152803579 17:82343784-82343806 ATTTGCATGTAGTTAAAAGTGGG + Intergenic
1153023598 18:654727-654749 ATTTGCATGTAATTGAAAGTAGG - Intronic
1153129735 18:1841193-1841215 ATTTGCATATAATTAAAAGTGGG + Intergenic
1153679577 18:7487392-7487414 GTTTGCATGTAATAGTGAGCAGG + Intergenic
1155372513 18:25116637-25116659 ATTAGCATGTGAATAAAAGCAGG + Intronic
1155523933 18:26697534-26697556 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1155630133 18:27883417-27883439 ATTTGCATGCACTTAAAAGTAGG - Intergenic
1156541528 18:37916530-37916552 ATATCCAAGTATTTGAAAGCAGG - Intergenic
1156802333 18:41131412-41131434 ATTTGCATGGATTTGGAAGAGGG + Intergenic
1157076306 18:44471412-44471434 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1158354566 18:56602771-56602793 CTTTCCATGTATTTGAAAACTGG - Exonic
1158733570 18:60054080-60054102 ATTTACATATGATTAAAAGCTGG - Intergenic
1159095830 18:63900563-63900585 ATCTACATGTAATTAAAAGTAGG - Intronic
1159108469 18:64029285-64029307 ATTTGCATGTAATTATAAGAGGG - Intergenic
1159184446 18:64950419-64950441 ATTTGCATGTAAGTAATAGCGGG - Intergenic
1159246997 18:65819259-65819281 ATTTGCATGTAATTGAAATTGGG + Intronic
1159310496 18:66701639-66701661 ATTTGCATGTAATTAAAAGTAGG + Intergenic
1159337077 18:67082056-67082078 ATTTGCATGCAATTGAATGTGGG + Intergenic
1159616528 18:70586460-70586482 TTTTGTATGTAATTGAAATTGGG + Intergenic
1159897822 18:74013325-74013347 ATTTGCATGTAATTGAAAGTAGG - Intergenic
1159902506 18:74060764-74060786 GTTTGCATGTAATTTAAAGTGGG + Intergenic
1160062871 18:75548673-75548695 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1160341627 18:78094284-78094306 ATTTGCATGCAGTTGAAAGCAGG - Intergenic
1160440039 18:78882822-78882844 ATTTCCCTGTCATTGGAAGCTGG - Intergenic
1161248115 19:3266108-3266130 ATTTAAATGTAATTAAAAGTGGG - Intronic
1161444959 19:4313046-4313068 AGTTACAAGAAATTGAAAGCTGG + Intronic
1161525790 19:4754248-4754270 ATTTGCATATAATTAAAAGTGGG - Intergenic
1161970702 19:7578320-7578342 CTTTGCATGCAATTAAAAGTAGG - Intergenic
1162219524 19:9164318-9164340 ATTTGCATGTAATTAAAACTGGG - Intergenic
1162263781 19:9553207-9553229 ATCTACATGTAATTAAAAGTAGG + Intergenic
1162613938 19:11780285-11780307 TCTTTCATGTATTTGAAAGCAGG - Exonic
1162663018 19:12185119-12185141 ATTTGCATATAATTGAAAGTGGG - Intronic
1163512443 19:17743597-17743619 ATTTGCATATAATTAAAAGTGGG - Intergenic
1163568318 19:18065035-18065057 ATTTGCATATAATTAAAAGCGGG + Intronic
1164088885 19:21930280-21930302 ATCTGGATGCAGTTGAAAGCTGG + Intergenic
1164193774 19:22935286-22935308 ATGTGCAGGTAGTTGAAAGTTGG + Intergenic
1164561004 19:29292254-29292276 ATTTGCATGTCATTAAAAGTGGG - Intergenic
1164572506 19:29384734-29384756 ATCTGCATGTAATTAAAAGTGGG - Intergenic
1164779843 19:30883457-30883479 ATTTGCACGTAATTAAAAGTAGG + Intergenic
1164855825 19:31519965-31519987 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1164897514 19:31890211-31890233 CTCTGCATGTAATTAAAAGTGGG - Intergenic
1164974109 19:32558915-32558937 ATTTGCATGTAATTAAAAGTAGG + Intergenic
1165103147 19:33451014-33451036 CTCTGCATGTAATTAAAAGTGGG + Intronic
1165134743 19:33660739-33660761 GTTTGCATGCAATTGAAAGTGGG + Intronic
1165150244 19:33756028-33756050 ATTTGCAGGGAACTGGAAGCCGG - Intronic
1165278611 19:34776842-34776864 ATCTGCATGTAATTAAAAGTGGG - Intergenic
1165881374 19:39046359-39046381 ATTTGCATGTAACTGAAAGTGGG + Intergenic
1165984459 19:39755827-39755849 ATTTGGCTGTAAGTGAAAGATGG - Intergenic
1166584832 19:43936499-43936521 ATTTGCATGTAATGAAAAGTTGG + Intergenic
1166652586 19:44585735-44585757 ATTTGCATGTAAGTGAAAGTTGG - Intergenic
1166955280 19:46460121-46460143 ATTTGCATATAATTAAAAGTGGG - Intergenic
1167082933 19:47289711-47289733 ATTTGCATATAATTAAAAGTGGG - Intergenic
1167652489 19:50740372-50740394 ATTTGCATATAATTAAAAGTGGG + Intergenic
1167692427 19:50994650-50994672 ATTTGCATGTAATTGAAAATGGG + Intergenic
1167819173 19:51910346-51910368 CTTTGCATATAATTAAAAGTGGG + Intronic
1167975915 19:53225864-53225886 GTTTGCATGTAATTAAAAGTGGG + Intergenic
1168130764 19:54317085-54317107 ATTTGCATATAATTAAAAGCAGG + Intergenic
1168582790 19:57569373-57569395 CTTTGCATGTAGTTAAAAGCGGG + Intergenic
925027112 2:618751-618773 ATCTGCATGCAATTAAAAGTGGG + Intergenic
925458558 2:4040721-4040743 AATTCCAAGCAATTGAAAGCTGG - Intergenic
925475260 2:4206262-4206284 ATTTGCATATAATTAAAAATGGG - Intergenic
925532622 2:4881810-4881832 ATCTGCATGCAATTAAAAGTAGG - Intergenic
925958221 2:8990364-8990386 TTTTGTATTTTATTGAAAGCAGG - Intronic
926144637 2:10389240-10389262 ATTTGCATGTAATTAAAAGTGGG + Intronic
926438338 2:12860481-12860503 ATTTGCATATACTTAAAAGTGGG - Intergenic
926564454 2:14454413-14454435 ATTTGCATGTAATTAAAAATGGG + Intergenic
926713349 2:15901961-15901983 ATTTCCAAAGAATTGAAAGCAGG + Intergenic
927382360 2:22493460-22493482 ATCTGCATGTTATTAAAAGTGGG + Intergenic
928346564 2:30503027-30503049 ATTTGCATGTAATTGAAAGTAGG - Intronic
930197436 2:48523549-48523571 ATATGCATGAAATAAAAAGCAGG - Intergenic
930865141 2:56115346-56115368 ATCTGCATGTAATTAAAAGTAGG - Intergenic
930891179 2:56389704-56389726 ATCTGCATGCAATTAAAAGTGGG - Intergenic
930903086 2:56532011-56532033 ATTTGCATGTAATTGGAAGTGGG - Intergenic
931202946 2:60118053-60118075 ATTTGTATGTAATTGAAAGAAGG - Intergenic
931965438 2:67528698-67528720 ATTTGCATATAATTGGAAATGGG + Intergenic
931972127 2:67600480-67600502 ATTTGTATGTAATTATAAGTGGG - Intergenic
932409998 2:71540600-71540622 ATTTTCATTTTATTGATAGCTGG + Intronic
932789877 2:74645667-74645689 ATTTGCATGTAATTAAAACTGGG + Intronic
932945762 2:76228442-76228464 ATTTACATGTAATTAAAAAGTGG + Intergenic
933032837 2:77354025-77354047 ATTTGCATGTAATTAAAAGTGGG - Intronic
933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG + Intergenic
933670182 2:84999696-84999718 ATTTGCATATAAGAGAAAGGGGG + Intronic
933941890 2:87251992-87252014 ACTTGCATGTAATTAAAAGTGGG - Intergenic
934055551 2:88248522-88248544 ATCTGCATGTAATTAAAAGTAGG - Intergenic
934134479 2:88982533-88982555 ATTAGCATGTCATTAAAAGTGGG - Intergenic
934235827 2:90231247-90231269 ATTAGCATGTCATTAAAAGTGGG + Intergenic
934719933 2:96566825-96566847 ATTTGCATATAATTAAAAGTGGG + Intergenic
934890436 2:98063625-98063647 ATTTGCATATAATTAAAAGTGGG + Intergenic
935120323 2:100178422-100178444 ATTTGCATATAATTGAAAGTGGG + Intergenic
935288432 2:101587849-101587871 ATTTGCACATAATTAAAAGTGGG - Intergenic
935327899 2:101954467-101954489 ATTTACATTTAATTGCAATCTGG + Intergenic
935383565 2:102478488-102478510 TTCTGCATGAACTTGAAAGCTGG + Intronic
935845988 2:107166222-107166244 ATTAGCATGTAGGTGAATGCAGG - Intergenic
935876615 2:107514630-107514652 ATTTTCATGTAATTAAAAGTGGG + Intergenic
936338332 2:111609577-111609599 ACTTGCATGTAATTAAAAGTGGG + Intergenic
936344940 2:111668279-111668301 ATTTGCATGTAATTAAAAGTGGG + Intergenic
936623850 2:114127252-114127274 ATTTTAAAGAAATTGAAAGCTGG - Intergenic
937053432 2:118910984-118911006 AGTTACATGTAGTTAAAAGCAGG - Intergenic
939810091 2:146821015-146821037 CTTTGAATGTAATAGAAAGAGGG + Intergenic
940123850 2:150300064-150300086 ATATGCATATAATTAAAAGTGGG + Intergenic
940586323 2:155656463-155656485 ATTTGCCTGTATTCCAAAGCTGG + Intergenic
941235481 2:162966942-162966964 ATTTGCATGCCTTTGGAAGCAGG + Intergenic
941664814 2:168234128-168234150 CTTTGCATGTTATTAAAAGGTGG + Intronic
941714554 2:168749940-168749962 ATGTGAATGTAATTAAAAGTGGG - Intronic
942846541 2:180432827-180432849 ATTAGCATGTCATTAATAGCAGG - Intergenic
942853591 2:180520134-180520156 TTTGGCACATAATTGAAAGCTGG + Intergenic
943030567 2:182680905-182680927 ATTTACATGTAATTGAAAGTAGG - Intergenic
943162065 2:184267508-184267530 ATTTGCATGCATATGAAAGTTGG - Intergenic
943442910 2:187947978-187948000 ATCTGCATGCAATTAAAAGTGGG + Intergenic
943473022 2:188318749-188318771 ATTTGCATGTAATTAAAAGCAGG + Intronic
944194077 2:197033891-197033913 ATTTGCAAGTCATTTAAAACTGG + Intronic
944305393 2:198173086-198173108 ATTTTCATAGAAATGAAAGCAGG - Intronic
944435239 2:199681763-199681785 ATTTGTATGTTATTTAAAGTGGG - Intergenic
944572314 2:201056940-201056962 ATTGGCATGTAATAGGAAGAGGG - Intronic
944649669 2:201816940-201816962 ATTTGCATATAACTAAAAGTGGG + Intronic
944654376 2:201863306-201863328 AATTGCAAGTGAGTGAAAGCAGG + Intronic
945050007 2:205814737-205814759 ATTAGAAGGTAAATGAAAGCTGG + Intergenic
945071753 2:205996872-205996894 ATATGCATGCAAATGAAAGAAGG - Exonic
945612977 2:212029136-212029158 ATCTGCATGTAATTAAAAGTGGG + Intronic
946520114 2:220455413-220455435 ATTTGAATTTAATTTAAAGATGG + Intergenic
946521643 2:220471320-220471342 ATTTTCATATAATTGAAATGGGG - Intergenic
946805878 2:223470996-223471018 ATTTGCATGTAATTAAAAGTGGG - Intergenic
946806662 2:223477333-223477355 ATTTGCATGTAATTAAAAGTGGG - Intergenic
946887854 2:224242121-224242143 ATTTGCATATAATTAAAAATGGG + Intergenic
946928608 2:224650304-224650326 ATTTGCATATAATTAAAATTGGG + Intergenic
947617179 2:231565703-231565725 ATTTGCATGTAATTAAAAGTGGG - Intergenic
948107988 2:235430432-235430454 ATTTGCATGTAATTAAAAGTGGG - Intergenic
948675880 2:239596392-239596414 ATCTGCATGCAATTAAAAGTGGG - Intergenic
948762893 2:240203615-240203637 ATTTCTATGTAATTAACAGCAGG - Intergenic
948880526 2:240855055-240855077 ATTTGCATGTCACTAAAAGTGGG - Intergenic
1168909423 20:1435254-1435276 ATTTGCATGTAATTAAAAATGGG + Intergenic
1169035421 20:2447178-2447200 ATTTGCATGTAATTGTAAGTGGG + Intergenic
1169271034 20:4199595-4199617 ATTTGCATGTAGTTAAAAGTAGG - Intergenic
1169501856 20:6168216-6168238 ATTTGCATATAATTAAAAGTGGG - Intergenic
1169848238 20:10020025-10020047 ATTTTCATGCAATGGAAAACTGG + Intronic
1170121723 20:12919493-12919515 ATTTGTATGTCATTAAAAGTGGG + Intergenic
1170303017 20:14907219-14907241 ATTTGCATACAATTGAAAGTAGG + Intronic
1170485230 20:16808874-16808896 TTTTACATGTAATTCGAAGCTGG + Intergenic
1170753694 20:19176783-19176805 ATTTGCATGTAATTATGAGTGGG + Intergenic
1171171008 20:23015398-23015420 ATTTACATGTAATTAAAACTGGG - Intergenic
1171325005 20:24283433-24283455 ATTTGCATGTAGTTGAAAGTAGG - Intergenic
1172199233 20:33113551-33113573 ACTAGCATGTAATTAAAAGTGGG - Intergenic
1172319625 20:33986204-33986226 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1172514799 20:35525850-35525872 ATTTGCATGTAGTTAAAAGTGGG - Intronic
1172570702 20:35968139-35968161 ATTTGCATGTGATTGAAAGTGGG - Intronic
1172582896 20:36062611-36062633 ATTTGCATGTAAATAAAAGTGGG + Intergenic
1173466374 20:43285251-43285273 ATTTGCGTATAACTGAAAGTAGG - Intergenic
1173532442 20:43780751-43780773 ATTTGCCTGTAATTGCTAGAAGG + Intergenic
1173887007 20:46468589-46468611 ATTTGCATATATTTAAAAGTGGG - Intergenic
1173891982 20:46519809-46519831 ATTTACATGTAATTGAAAGTGGG + Intergenic
1174670310 20:52301404-52301426 ATTTGCGTGTAGTTTAAGGCAGG + Intergenic
1174894794 20:54436921-54436943 ATCTGCATGCAATTAAAAGTAGG - Intergenic
1174970301 20:55267556-55267578 ATTTGCATATAATTAAAAGCAGG - Intergenic
1175138119 20:56840183-56840205 ATTTGCATTTAATTAAAAGTGGG - Intergenic
1175138256 20:56841044-56841066 ATCTGCATGCAATTAAAAGTAGG + Intergenic
1175509615 20:59515043-59515065 CTTTGCATGTAATTAAAAGTGGG - Intergenic
1175569392 20:60007526-60007548 ATTTGCATGTAATTGAAAGTGGG - Intronic
1175675436 20:60942722-60942744 ATCTGCATGTTATTAAAAGTGGG + Intergenic
1175713823 20:61242268-61242290 ATTTGCATGTAACTTAAAAGCGG - Intergenic
1175731708 20:61358699-61358721 ATTTGCCTGTTTTTGAAGGCTGG + Intronic
1176518023 21:7800886-7800908 ATTTGCATATAATTAAAAGTGGG - Intergenic
1177348930 21:19910018-19910040 TTCTACATGTAATTAAAAGCAGG - Intergenic
1178037910 21:28605194-28605216 ATTGGCATGTATTAGAATGCTGG + Intergenic
1178042347 21:28653030-28653052 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1178240417 21:30893471-30893493 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1178652051 21:34430899-34430921 ATTTGCATATAATTAAAAGTGGG - Intergenic
1179310148 21:40188200-40188222 ATTTCAGTGTAATTGAAAGTAGG + Intronic
1179427360 21:41292320-41292342 ATTTGCATATAATTAAAAGTGGG - Intergenic
1180931303 22:19593690-19593712 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1181447600 22:22990045-22990067 ATCTGCATGTTATTAAAAGTGGG - Intergenic
1181753664 22:25007762-25007784 ACTTGCATGTAATTAAAAGTGGG + Intronic
1181754916 22:25016993-25017015 ATTTGCATATAATTAAAAGTGGG - Intronic
1181910014 22:26231190-26231212 ATTTGCATGTAATTAAAAGTGGG - Intronic
1182029601 22:27147478-27147500 ATTTGCATATAATTAAAAGTGGG + Intergenic
1182111091 22:27724272-27724294 ATTTGCATGTAATGAGAAGTGGG - Intergenic
1182186276 22:28405860-28405882 ATTTGCATGTAATTAAAAGTGGG + Intronic
1182192183 22:28473553-28473575 ATTTGCATATAATTAAAAGTGGG + Intronic
1182572903 22:31252116-31252138 ATTTGGATGTAAGTGAGGGCTGG + Intronic
1182971590 22:34584284-34584306 ATTTGCATATAATTAAAAGTGGG - Intergenic
1183336457 22:37250211-37250233 ATTTGCATGTGACTAAAAGTGGG + Intergenic
1183356008 22:37359927-37359949 ATTTGCATGTGATGAAAAGTGGG - Intergenic
1183560078 22:38565493-38565515 ATTTGCACGTAATTAAAAGTGGG + Intronic
1183566923 22:38622150-38622172 ATTTGCCTGTAATTAAAAGTGGG + Intronic
1184434841 22:44464945-44464967 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1184866913 22:47206475-47206497 ATTTACATGTAATTAAAAGTGGG + Intergenic
1185131894 22:49044020-49044042 ATTAGCATGTAGTTAAAAGTGGG - Intergenic
1185242920 22:49756007-49756029 ATTTGCATGTAATTGAAAGTGGG + Intergenic
949201369 3:1383791-1383813 ATTTGCATGTAATTAGAAGTGGG - Intronic
949255098 3:2036380-2036402 ATTTGCATATAATTAAAAGTGGG + Intergenic
949712280 3:6885329-6885351 ATTTGCATATAATTAAAAGTGGG - Intronic
949737229 3:7187661-7187683 ATCTGCATGTAATTAAAAGTGGG - Intronic
950629741 3:14274565-14274587 ATTTGCATATAATCAAAAGTGGG - Intergenic
950685059 3:14611050-14611072 ATTTGCATGTAATAAAAAGTGGG - Intergenic
950700434 3:14741827-14741849 ATCTATATGTAATTAAAAGCAGG - Intronic
950779374 3:15378195-15378217 ATATACAAGTAATTGAAAGTGGG - Intergenic
952564454 3:34638200-34638222 ATTTGCATGTAGTTAAAAGTGGG - Intergenic
953408188 3:42670675-42670697 ATTTGCATGTAAGTCAAAGTGGG - Intergenic
954803502 3:53201366-53201388 ATTTGCATATAATTAAAAGTGGG + Intergenic
955570749 3:60302785-60302807 AATTCCATCTAATTGAAAACTGG + Intronic
955746372 3:62144543-62144565 AGTTCCATGTAATTAAATGCTGG - Intronic
956419745 3:69074927-69074949 ATTTGCCTGGAATTGAATCCAGG - Intronic
956467998 3:69537512-69537534 ATTTGCACATAAATGAAAACAGG + Intronic
956489982 3:69760511-69760533 ATTTGCATGTAATTCCAAGTGGG - Intronic
956784453 3:72630758-72630780 ATTTACTTCTAATTGAAAGCTGG + Intergenic
957383074 3:79459396-79459418 ATTTGCATGTAATTTACCACAGG + Intronic
957415353 3:79895165-79895187 ATTTGCATGTAATTAAAAGTGGG + Intergenic
957688466 3:83536384-83536406 ATTTGCAAGGAACTCAAAGCTGG + Intergenic
958798518 3:98731879-98731901 ACTTGGATGTAATTCAAAGTTGG - Intergenic
958820775 3:98971189-98971211 ATTGGCATGTAATTTAGAGAAGG - Intergenic
959061904 3:101623732-101623754 ATTTCCATATAATTAAAAGTGGG - Intergenic
959129557 3:102337346-102337368 ATGTACATGTAATTAAAAGTAGG + Intronic
959266225 3:104142299-104142321 ATTTGCATTTGATTAAAAGGGGG + Intergenic
959333042 3:105030603-105030625 ATTTGCATATAATTAAAAGTGGG + Intergenic
959458331 3:106591766-106591788 ATTTGCATATAATTAAAAATGGG + Intergenic
959780542 3:110227628-110227650 ATTTGCATGTAATTAAAAGTGGG + Intergenic
959876851 3:111393189-111393211 ATTTGCATGTAATTGAAAGTAGG + Intronic
960012849 3:112852143-112852165 ATTTCCATGTAATTGTATGGTGG - Intergenic
960636395 3:119789035-119789057 ATCTGTATGTACTTGAAAGCTGG + Intronic
961298125 3:125903561-125903583 ATCTGCATGCAATTAAAAGTGGG + Intergenic
961503571 3:127355280-127355302 ATTTGCATGTAATTAAAAGTGGG - Intergenic
961527234 3:127512905-127512927 ATTTGCATGTAATTAAACATGGG + Intergenic
962275367 3:134009405-134009427 ATTTGCATGTATTTTATAGATGG + Intronic
963726093 3:148923221-148923243 ATTCGCATATAATTAAAAGCAGG - Intergenic
964142603 3:153420611-153420633 ATTTGCATGTAAGTGGACCCTGG - Intergenic
964197296 3:154079517-154079539 ATTTGCACATAATTAAAAGTGGG - Intergenic
965184852 3:165449711-165449733 ATTTGCAAATATTAGAAAGCAGG + Intergenic
966072567 3:175896453-175896475 ATTTGCATATAATTTAAAGTGGG + Intergenic
966414837 3:179677989-179678011 AGTTGCATGAAATTTAAAGGGGG - Intronic
967620499 3:191627943-191627965 ATTTGTATGTAATTAAAAGTGGG + Intergenic
968600117 4:1504708-1504730 ATTTGCATATCATTAAAAGTGGG - Intergenic
969191521 4:5524918-5524940 ATTAGCATATAATTAAAAGTGGG - Intronic
969218462 4:5742987-5743009 ATTTGCATGTAATTGAAAGTGGG - Intronic
969359105 4:6650178-6650200 ATTTGCATGTAATTAAAAGTGGG + Intergenic
969754928 4:9143207-9143229 ATCTGCATGCAATTAAAAGTGGG + Intergenic
969814830 4:9679490-9679512 ATCTGCATGCAATTAAAAGTGGG + Intergenic
970073209 4:12186837-12186859 ATTTGCATGCAATTAAAAGTGGG - Intergenic
971587305 4:28420831-28420853 ATGTGCATGTACTATAAAGCTGG + Intergenic
971911040 4:32798238-32798260 ATCTACATGTAATTAAAAGCAGG + Intergenic
972413018 4:38811619-38811641 ATCTGCATGCAATTAAAAGTGGG + Intronic
973148515 4:46859840-46859862 ATTTGCATGTAATTAAAAGTGGG + Intronic
974255489 4:59448280-59448302 TTCTACATGTGATTGAAAGCTGG + Intergenic
974275119 4:59709752-59709774 ATTTTCATAAATTTGAAAGCAGG + Intergenic
975445662 4:74462271-74462293 ATATACATGTAATTTAAAGGTGG + Intergenic
975966311 4:79976562-79976584 ATTTTCATATAATTAAAAGTGGG + Intronic
977825275 4:101523948-101523970 ATTTGTATGTGATTGAAAGTGGG + Intronic
977885373 4:102246891-102246913 ATTTGTCTGAAATTAAAAGCAGG - Intergenic
979511222 4:121556069-121556091 ATTTGCATGTAATTAAAAGCAGG + Intergenic
979647891 4:123093303-123093325 ATTTGCATGTAAATGAAAGTGGG - Intronic
980314662 4:131182116-131182138 ATTAGCATGTAATTAGAAGTAGG + Intergenic
980514955 4:133844892-133844914 ATTGGGATGACATTGAAAGCAGG - Intergenic
980547730 4:134290657-134290679 TTTTGCATTTAATTTACAGCTGG + Intergenic
981118152 4:141016425-141016447 ATTAGCATGTCATTAAAAGCAGG + Intronic
981916524 4:150039901-150039923 ATTAGCATGTCATTAAAAGTGGG - Intergenic
982378871 4:154726320-154726342 CTTTGCATGTAATTGCTAGTGGG - Intronic
982652443 4:158103166-158103188 ATTTGCACATAATTAAAAGTTGG - Intergenic
982858143 4:160411713-160411735 AGCTGCATGTAATTGACAGAAGG - Intergenic
984151053 4:176130943-176130965 ATATTTATGTAATTGAAAGTAGG + Intronic
984274816 4:177597094-177597116 ATTTGCATGTAGTTAAAAGTGGG - Intergenic
985700470 5:1368867-1368889 AGTTGCACGTAATTGAAAGCGGG + Intergenic
986201804 5:5586030-5586052 ATTTGCAGGTAATTGAAAGTGGG - Intergenic
986209502 5:5657372-5657394 AATTGCATGTAGTTGAAAATGGG + Intergenic
987197730 5:15544051-15544073 ATTTGCATGTAATTAAAAGTGGG + Intronic
987270235 5:16300454-16300476 ATTTGCATGTGAATGAAATGGGG - Intergenic
987496938 5:18658244-18658266 ATCTGCATGCAATTAAAAGTGGG - Intergenic
988226054 5:28412434-28412456 ATTTGCATATGATTGGAAGTTGG - Intergenic
988936634 5:36090032-36090054 ATTTGCATGTAATTGAAAGTGGG - Intergenic
989311321 5:40022094-40022116 GTTTGCATGCAATTGAAAGTGGG - Intergenic
989806701 5:45617162-45617184 ATGTGCAAGCAATTGAAAGCTGG - Intronic
990511379 5:56492393-56492415 GTCTACATGTAATTAAAAGCAGG - Intergenic
990647200 5:57858121-57858143 ATTTACAGGTAATTGAAAGCAGG - Intergenic
991944422 5:71885732-71885754 ATTTGCATGTAATTAAAAGTGGG - Intergenic
992260153 5:74961566-74961588 ATTTCCATCTAATAGAAAGATGG - Intergenic
992354429 5:75966612-75966634 ATTTGCATGTAATTAAAAGTGGG + Intergenic
992508465 5:77410292-77410314 ATTTGCATGTAATGAAAAGTAGG - Intronic
994238290 5:97391314-97391336 ATTTGCATGTAATTGAAAGTGGG + Intergenic
994670044 5:102754215-102754237 ATATGCGTTTAATTGAAGGCAGG - Intronic
994801290 5:104380430-104380452 ATTTGCATATAATTAAAAGTGGG + Intergenic
994905528 5:105837762-105837784 ATTTGCATAAAATTAAAAGTGGG + Intergenic
994968614 5:106706713-106706735 ATTAGCATAAAATTGAAAGTAGG - Intergenic
995199840 5:109413602-109413624 ATTAGCATATAATTAAAAGTGGG - Intergenic
995370475 5:111412894-111412916 ATTTATATGTAATTAAAAGTGGG + Intronic
996303289 5:122015451-122015473 ACTTGCATGTAATTTAGAGCAGG + Intronic
996543055 5:124649504-124649526 GTGTGCCTGTAATTGAAACCAGG - Intronic
996573749 5:124960579-124960601 ATTTGCATATAATTAAAATTCGG - Intergenic
996930516 5:128880909-128880931 ATTTGCATGTAATTAAAAGTCGG - Intronic
997026517 5:130069052-130069074 ATTTACAGGTAATTGAACCCTGG - Intronic
997065232 5:130551732-130551754 ATTTGCATATAATTAGAAGTGGG + Intergenic
997065373 5:130553538-130553560 ATTTGCATGCAATTGAAAGTGGG + Intergenic
997070566 5:130617640-130617662 ATCTGCATGTAGTTAAAAGTGGG + Intergenic
997525457 5:134550139-134550161 ATTAGCATTTAATTGTAATCTGG + Intronic
998323084 5:141250970-141250992 ATTTGCATGTAAGTGAAAATAGG + Intergenic
998496922 5:142598869-142598891 ATTTTTATATAAGTGAAAGCAGG + Intronic
999034599 5:148333499-148333521 ATTTGCATATAATTAAAAGTGGG - Intronic
999541924 5:152583999-152584021 ATTTACATGTAATGGATAGTAGG + Intergenic
999573046 5:152942590-152942612 AATTGCATGTAGCTGGAAGCAGG + Intergenic
1000520893 5:162293375-162293397 ATCTACATGTAATTAAAAGTAGG + Intergenic
1000543566 5:162570511-162570533 ATTTGCATGTAATTAAAAGTAGG + Intergenic
1000593450 5:163186275-163186297 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1000646504 5:163766370-163766392 ATTTGCATATAATCAAAAGTGGG - Intergenic
1000825107 5:166035049-166035071 ATTTGAATGTAGCTGAAACCAGG + Intergenic
1001437482 5:171711594-171711616 ATTTGCATATAAATAAAAGTGGG - Intergenic
1003043813 6:2714363-2714385 ATTTGCATGTAATTGAAAGTGGG + Intronic
1003423637 6:5981017-5981039 ATTTGAAAGTGATGGAAAGCTGG - Intergenic
1003924237 6:10861882-10861904 ATTTGCATATAATTAAAATGAGG + Intronic
1004035456 6:11918752-11918774 AAAAGCATGTAATTAAAAGCTGG + Intergenic
1004554931 6:16687086-16687108 ATTGGCATGTAATTACAACCAGG + Intronic
1004840402 6:19577447-19577469 ATTTGCATGTAATTAAAAGTAGG - Intergenic
1005686082 6:28254289-28254311 ATTTGCATATAATTAAATGTAGG - Intergenic
1006199624 6:32276592-32276614 ATTGGCATATGATTGAAAGTGGG - Intergenic
1006722098 6:36162149-36162171 ATTTGCATGTACTTTAAAGTGGG + Intergenic
1006899052 6:37488369-37488391 GTGTGCATGTAGTTGAGAGCTGG - Intronic
1008146887 6:47902673-47902695 ATTTATATGTAATTAAAAGGAGG - Intronic
1008206914 6:48671539-48671561 ATTTGCATGTTATTGAAAGTGGG - Intergenic
1008334773 6:50289260-50289282 TTTTGCAGGTAATGCAAAGCCGG - Intergenic
1008717701 6:54308994-54309016 ATTTTCATTTCATTGAAAGAAGG - Intronic
1009827566 6:68886201-68886223 ACTTGCTTGTACTTGCAAGCTGG + Intronic
1010675920 6:78742779-78742801 ATTTGCATGCAATTGTAAGTGGG + Intergenic
1010870143 6:81026706-81026728 ATTTGTATGTAATTAAAAGTAGG - Intergenic
1011178599 6:84593096-84593118 ATTTGCATATAATTAAAAGTGGG - Intergenic
1011482577 6:87809762-87809784 ATTTGCATATACTTTAAATCAGG - Intergenic
1011545399 6:88477411-88477433 ATTTACATATAATTGAAAGTGGG - Intergenic
1011836900 6:91442683-91442705 ATTTGCTGTTAATTGAAAACAGG + Intergenic
1012772358 6:103454971-103454993 ACTTGCATGTAATTAAAAGCGGG + Intergenic
1013284319 6:108667435-108667457 ATTTGAGTGTAATTGTAAGGAGG + Intronic
1013420682 6:109963898-109963920 TTTTGCATGTAATTAAAAGTGGG + Intergenic
1013509375 6:110830558-110830580 ATTTGCATGTGATTAAAACTGGG + Intronic
1013708267 6:112865373-112865395 ATTAGCATGTCATTAAAAGTGGG - Intergenic
1013831565 6:114279201-114279223 ATCAGCATTGAATTGAAAGCAGG + Intronic
1014068825 6:117157921-117157943 ATTTGAATTTAATTTAAATCTGG + Intergenic
1014250037 6:119105747-119105769 ATTTTCATCTAATACAAAGCTGG + Intronic
1014533187 6:122585040-122585062 ATTTGCATATAATTAAAAGTGGG + Intronic
1014592333 6:123289675-123289697 ATCTTCATGCAATTGAAAGTGGG + Intronic
1014592994 6:123295255-123295277 ATATGCATGCAATTAAAAGTGGG + Intronic
1014916804 6:127160575-127160597 ATTTGCATCTAATTAAAAGTGGG - Intronic
1015068666 6:129061888-129061910 ATTTTCAGGAAATAGAAAGCTGG - Intronic
1015408751 6:132867960-132867982 ATTGGCATGAAATTTAAAGCAGG - Intergenic
1015610989 6:135018429-135018451 ATTTACATAAAATTGAAATCTGG - Intronic
1015771345 6:136771565-136771587 ATCTGCATGCAATTAAAAGTAGG + Intronic
1016519571 6:144931437-144931459 ATTCACATGTAACTGAAAGTGGG - Intergenic
1016548060 6:145246362-145246384 ATTTGCATATAATTAAAAGTGGG + Intergenic
1017385510 6:153878340-153878362 GTTTGCATGAAATTAAAAGTGGG - Intergenic
1017736490 6:157369521-157369543 ATCTGCATGTAATTAAAAGTGGG + Intergenic
1018080236 6:160253295-160253317 ATTTGCATATAATTAAACGTGGG - Intronic
1018158519 6:161013765-161013787 ATTTACATGTAATTGAAAACAGG - Intronic
1018262705 6:161986179-161986201 ATCTGCATGTAATTACAAGTAGG + Intronic
1018274216 6:162113018-162113040 ATTTTCATGAAAATGGAAGCAGG + Intronic
1018372466 6:163180914-163180936 CATTTCATGTATTTGAAAGCTGG + Intronic
1018832019 6:167450536-167450558 ATTTGCAACTCATTGAAAGATGG + Intergenic
1019029082 6:168995020-168995042 ACTTGCATGTAATTAAAAGTGGG - Intergenic
1019674186 7:2301564-2301586 GTTTGCATATAATTAAAAGTAGG - Intronic
1019954330 7:4401406-4401428 ATTTGCAGGTAATTAAAAGTGGG - Intergenic
1020782033 7:12529925-12529947 ATTTGCATGTAGTTAAAAGTGGG - Intergenic
1020856784 7:13437087-13437109 ATTTGTATGTAATTAAAATTGGG - Intergenic
1021289614 7:18826609-18826631 ATTTGGCTGTAAGTGAAAGGAGG + Intronic
1021650306 7:22826658-22826680 ATCTACATGTAATTAAAAGTAGG - Intergenic
1021650431 7:22827827-22827849 ATTTGCATATAATTAAAACTGGG + Intergenic
1022007664 7:26281023-26281045 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1022052068 7:26685796-26685818 ATTATCATGAAATTGAAAACAGG - Intronic
1022299471 7:29089704-29089726 ATCTGCATGTAATTAAAAGTGGG + Intronic
1022687804 7:32612928-32612950 ATTTGCGTATAATTAAAAGTGGG - Intergenic
1023133258 7:37025019-37025041 ATTTGCTTATAATTGAAAAATGG + Intronic
1024104824 7:46072286-46072308 ATTTTCATGGACTTGAGAGCTGG - Intergenic
1024187707 7:46970105-46970127 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1024747676 7:52427188-52427210 ATTTGCATGTAATTGTAAGTCGG + Intergenic
1024780892 7:52847032-52847054 ATTTGAATATAATTGAAAGTTGG + Intergenic
1026009493 7:66625796-66625818 ATTTGCATATAATTAAAAGTTGG + Intergenic
1026128052 7:67596894-67596916 ATTTGAATGTAATTAAAAGGGGG - Intergenic
1026357311 7:69569865-69569887 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1026535102 7:71232739-71232761 ATTTGCGTGTAATTAAAAGTGGG - Intronic
1026664695 7:72332274-72332296 ATTTGCCTGTAACTAAAAGTGGG - Intronic
1026674302 7:72416257-72416279 ATTTGCATATAATTAGAAGTGGG + Intronic
1026877730 7:73889179-73889201 ATTTGCATATAATTGAAAGTGGG + Intergenic
1027127382 7:75566439-75566461 ATTTACATATAATTAAAAGTGGG - Intronic
1027538824 7:79441868-79441890 ATATTCATATTATTGAAAGCAGG + Intronic
1027582663 7:80018526-80018548 ATTTCCAGGTAATTGAAGCCAGG + Intergenic
1027797193 7:82710503-82710525 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1027846463 7:83383621-83383643 ATTTGAATGTAGTTGAAAATAGG + Intronic
1028075063 7:86502497-86502519 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1028485827 7:91356161-91356183 ATTTGTTTGTAAATGAGAGCAGG - Intergenic
1028498585 7:91490870-91490892 ATTTATATGAAATTTAAAGCAGG - Intergenic
1028559827 7:92161919-92161941 ATGTGCATGTAAGTGACAGCAGG + Intronic
1028574874 7:92337723-92337745 ATTGGCATGTAATTCAAGCCAGG - Intronic
1029161210 7:98553433-98553455 ATTTGCAGGTAATCAAAAGTGGG + Intergenic
1029322005 7:99770489-99770511 ATTTGCATGTAAAAGAAGACTGG - Intronic
1029427654 7:100506616-100506638 ATTTGCATATAATTAAAAATGGG - Intergenic
1029577377 7:101412342-101412364 ATTTGCATACAATTAAAAGTGGG + Intronic
1029600310 7:101559400-101559422 ATCTGCATGCAATTAAAAGTAGG - Intergenic
1029817928 7:103115808-103115830 ATTTACATATAATTAAAAGTGGG - Intronic
1030222211 7:107109033-107109055 TTTAGCATGTAATTAAAAGTGGG - Intronic
1030542589 7:110850444-110850466 ATTTACATATAACTGAAAGTGGG + Intronic
1030776769 7:113543334-113543356 ATTTGCATATAATTGAAAGTGGG + Intergenic
1031668130 7:124510823-124510845 ATTTGCTTGTAACTGAAAGTGGG - Intergenic
1031823698 7:126535558-126535580 CTCTGCATGCAATTGAAAGTAGG - Intronic
1031892329 7:127309139-127309161 ATTTGCATATAATTAAAAGGGGG + Intergenic
1031920116 7:127594284-127594306 ACTTGCCTGTATATGAAAGCAGG + Intronic
1033527281 7:142228773-142228795 ATTTACATGTGATTAAAAGTAGG - Intergenic
1034110000 7:148527626-148527648 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1034347307 7:150395406-150395428 GTTTACATGTAATTAAAAGTAGG - Intronic
1034383994 7:150722759-150722781 ATTTGCATATAGTTGAAAGTGGG - Exonic
1034707340 7:153157300-153157322 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1034974012 7:155437443-155437465 ATTTGCATATAATTAAAAGTGGG - Intergenic
1035819923 8:2580150-2580172 ATTTGCATATAATTAAACACAGG - Intergenic
1036133506 8:6138247-6138269 ATTTTCCTGAAAATGAAAGCTGG + Intergenic
1036378161 8:8218522-8218544 ATCTGCATGCAATTAAAAGTGGG + Intergenic
1036674133 8:10815609-10815631 TTTTGCATGCAATTTAAAGGAGG + Intronic
1036732292 8:11276573-11276595 ATTTGCATGTAATTAAAAGTAGG + Intergenic
1036913063 8:12775101-12775123 ATTAGCATATCATTGAAAGTGGG + Intergenic
1036926630 8:12913280-12913302 ATTCGCATGTAATCAAAAGTAGG - Intergenic
1037108157 8:15135926-15135948 ATTTGCATATAATTAAAAGTAGG - Intronic
1037247925 8:16857991-16858013 ATCTACATGTAATTAAAAGTAGG - Intergenic
1037471467 8:19215444-19215466 ATTTACATATAATTGAAAGTGGG + Intergenic
1037530682 8:19769816-19769838 ATTTGCATGTCATTAAAAGTGGG + Intergenic
1037715996 8:21400783-21400805 ATTTGCATTTAATTAAAAGTGGG - Intergenic
1037742692 8:21620071-21620093 ATGTGCATGGAATAGACAGCTGG + Intergenic
1038223402 8:25632102-25632124 ATCTGCATGTAACTAAAAGTAGG - Intergenic
1038375200 8:27033137-27033159 ATTTGCATGCAATTGAAAGTGGG - Intergenic
1038448987 8:27626797-27626819 ATTTGCATATAATTAAAAGTGGG + Intergenic
1038490926 8:27970532-27970554 ATTTGCATATAATTAAAAATGGG + Intronic
1038542958 8:28404159-28404181 TGTTACATGTAATTGAAAGTAGG + Intronic
1039157657 8:34579717-34579739 ATTTGCATATAATTCAAAGTGGG + Intergenic
1039324988 8:36475197-36475219 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1040011413 8:42664099-42664121 ATTTGGATGTCATTAAAAGTGGG + Intergenic
1040018081 8:42716562-42716584 ATTTGCATATAATTAAAGGTGGG - Intronic
1041499405 8:58523628-58523650 ATTCGCATATAATTAAAAGTGGG + Intergenic
1041520003 8:58745428-58745450 ATTTAAATGTAATTCAAAACAGG + Intergenic
1041840669 8:62266848-62266870 ATTTGTATATAATTAAAAGCAGG + Intronic
1042156655 8:65851379-65851401 ATTTGCATATAATTAAAAGTGGG + Intergenic
1042746872 8:72118085-72118107 ATTTGCATGTAATAAAAATTGGG + Intronic
1043654405 8:82643698-82643720 TTTTGCATGTAATTAAAACTGGG - Intergenic
1044136355 8:88591116-88591138 ATTGACATGTGATTCAAAGCGGG + Intergenic
1044252421 8:90019481-90019503 ATTTGCAGGCAATTAAAAGTGGG - Intronic
1044564805 8:93651530-93651552 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1044685411 8:94821700-94821722 ATCTGCATGCAATTAAAAGTGGG + Intronic
1044958993 8:97511288-97511310 TTTTCAATGTTATTGAAAGCTGG + Intergenic
1045363801 8:101457002-101457024 ATATCCATGAAACTGAAAGCTGG + Intergenic
1045493153 8:102685806-102685828 GGCTGCATGTAGTTGAAAGCAGG - Intergenic
1047280744 8:123443322-123443344 ATTTGCATGTTATTAAAAGTAGG + Intronic
1048468842 8:134689257-134689279 ATTAGCACGTCATTGAAAGTGGG + Intronic
1048711911 8:137221906-137221928 ATTTTCAAGTAATTCAAAACAGG - Intergenic
1048877687 8:138850018-138850040 CTTTCCTAGTAATTGAAAGCGGG + Intronic
1048938321 8:139375396-139375418 ATTAGCATGTCATTAAAAGTGGG - Intergenic
1049231138 8:141482527-141482549 AATTGCATGTAATTGGAAGCAGG + Intergenic
1049678624 8:143905012-143905034 ATTTGCATGTAAGTAAAAGTGGG + Intergenic
1050743764 9:8853491-8853513 ATTTGCTTCTAATTGGTAGCTGG - Intronic
1050991895 9:12166591-12166613 CTTTGCATGTAATCAAAAGTGGG - Intergenic
1050993065 9:12176036-12176058 ATCTGCATGTAATTAAAAGTGGG - Intergenic
1051011155 9:12416204-12416226 ATTTGCATGTAATTGAAAATGGG - Intergenic
1051803026 9:20958309-20958331 ATTTGCATATAATTGCCAGAAGG + Intronic
1052131647 9:24855620-24855642 ATTTGCACATAATTTAAAGTGGG + Intergenic
1052135611 9:24906358-24906380 ATTTGCATGTAATTAAGAGTAGG - Intergenic
1052618851 9:30879278-30879300 ATTTACATGGAATTAAAAGAGGG - Intergenic
1053125139 9:35574976-35574998 ATTTGCATGTAGTTAAAAGTGGG + Intergenic
1053572271 9:39321258-39321280 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1053623664 9:39845794-39845816 ATCTACATGTAATTAAAAGTAGG + Intergenic
1053881205 9:42597434-42597456 ATCTACATGTAATTAAAAGTAGG - Intergenic
1053891458 9:42696879-42696901 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1054093831 9:60879969-60879991 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1054115307 9:61155893-61155915 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1054124874 9:61297753-61297775 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1054220234 9:62404905-62404927 ATCTACATGTAATTAAAAGCAGG - Intergenic
1054230481 9:62504267-62504289 ATCTACATGTAATTAAAAGCAGG + Intergenic
1054592449 9:67026649-67026671 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1055033794 9:71796636-71796658 ATTTGCATGTAATTTAAAGTGGG + Intronic
1055079488 9:72255199-72255221 ATTTGCATGTAATTGAAAGCAGG - Intronic
1055710271 9:79053143-79053165 AGTTGGATGCAATTGATAGCAGG - Intergenic
1056444465 9:86652445-86652467 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1056618658 9:88191417-88191439 TTTTGCATGTAATTAAAAGTGGG - Intergenic
1056918337 9:90763542-90763564 ATTTGCAAGTAATTAAAAGCAGG - Intergenic
1058194593 9:101956918-101956940 ATTAGCATGTCATTAAAAGTGGG + Intergenic
1058222516 9:102319861-102319883 ATTTGCATTTATCTGATAGCCGG - Intergenic
1059267765 9:113051758-113051780 TTTTGCAGGTAATTGAATGGTGG - Intronic
1059420559 9:114188191-114188213 ATTTGCATATAATTAAAGGTGGG - Intronic
1059689310 9:116669244-116669266 ATTTGCATGTAATTAAAAGTGGG + Intronic
1059978389 9:119742703-119742725 ATTTGCATATAATTAAAAGTGGG + Intergenic
1060326943 9:122626026-122626048 ATTGTAATGTAATTGTAAGCAGG - Intergenic
1060382978 9:123194218-123194240 ATTTGCATGAAGTAGGAAGCAGG - Intronic
1061224542 9:129273127-129273149 ATTTGCATATAATTAAAAGTGGG + Intergenic
1061853130 9:133427812-133427834 ATTTGCATATAATTAGAAGTGGG - Intronic
1062131232 9:134894494-134894516 ATTTGCATTTAGTTAAAAGTGGG + Intergenic
1185562874 X:1073065-1073087 ATTTGCATGTAATTAGCAGCGGG + Intergenic
1185682369 X:1899094-1899116 ATTTGCATGTAATTAGCAGTGGG - Intergenic
1185803458 X:3034543-3034565 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1186010415 X:5125439-5125461 ATTTGCATGTTATTAAGAGTGGG + Intergenic
1186045695 X:5534212-5534234 ATCTGCATGTAATTAAAAGTGGG + Intergenic
1186604117 X:11071072-11071094 TTTTGCATATAATTAAAAGTGGG + Intergenic
1186757611 X:12689173-12689195 TTTTTCATGTACTTGAAAACTGG - Intronic
1187045132 X:15640303-15640325 ATCTACATGTAATTAAAAGTGGG + Intronic
1187096474 X:16153982-16154004 ATTTGAATTTATTTGAAAGTGGG - Intergenic
1187752621 X:22484151-22484173 ATTTTCATTTAATTGAAAAATGG - Intergenic
1188672633 X:32898561-32898583 ATTTACATGTAATTGAAAGTGGG - Intronic
1190251287 X:48728239-48728261 ATTTGCATGTAACTAAAAGGTGG + Intergenic
1190554760 X:51623054-51623076 ATTTGCAGGTAATTGAAAGAGGG - Intergenic
1190628405 X:52359956-52359978 ATATACACGTAATTGAAAGTGGG + Intergenic
1190682067 X:52834971-52834993 ATTTACATGGAACTGAAAGTGGG - Intergenic
1190953324 X:55167481-55167503 ATGTACATATAATTGAAAGTGGG + Intronic
1192416814 X:70988491-70988513 ATTTGCATGTAACTGAAAGTGGG - Intergenic
1193438282 X:81507463-81507485 ATTTGCAAATAATTCAAAGCAGG + Intergenic
1193844448 X:86451253-86451275 ATTTGCAGAAAATTGAAACCAGG - Intronic
1193859750 X:86650857-86650879 TTCTTAATGTAATTGAAAGCTGG - Intronic
1194067158 X:89275981-89276003 ATTTGCATGTAATTAAAAGTTGG - Intergenic
1194152783 X:90345670-90345692 ATTTGCATGTAATCGTAAGTGGG - Intergenic
1195092039 X:101469930-101469952 ATTTGCGTATAATTAAAAGTGGG + Intronic
1195267894 X:103201216-103201238 ATTTGCATGTAACTAAAGGTGGG + Intergenic
1195268841 X:103211368-103211390 ATTTGTGTGTAATTGAAAGTGGG + Intergenic
1195373924 X:104207038-104207060 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1195389215 X:104343662-104343684 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1195447414 X:104970501-104970523 ATTTGCACATAATTAAAAGTGGG - Intronic
1195539975 X:106052594-106052616 ATTTGCATATAATTAAATGTGGG - Intergenic
1195929062 X:110055146-110055168 ATTTGCATGGAATTGAAAACAGG - Intronic
1196904864 X:120421076-120421098 TTCTGCATGTAAGTGAGAGCTGG - Intergenic
1198175286 X:134148637-134148659 ATCTGCATGCAATTAAAAGTGGG + Intergenic
1198271345 X:135059049-135059071 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1198631841 X:138648067-138648089 ATGTGAATGTAATTGTAAGGAGG - Intronic
1198759779 X:140019187-140019209 ATTTGAATATAATTAAAAGTGGG - Intergenic
1198779006 X:140214863-140214885 ATTTGAATATAATTAAAAGTGGG + Intergenic
1198846593 X:140918771-140918793 ATTTGCATATAATTAAAAGTGGG + Intergenic
1199446550 X:147929699-147929721 ACTTGTATGTAACTGAAATCAGG + Intronic
1200499127 Y:3922415-3922437 ATTTGCATGTAATCGTAAGTGGG - Intergenic
1200721319 Y:6610190-6610212 ATTTGCATGTAATTAAAAGTTGG - Intergenic
1201139350 Y:11015417-11015439 AATGCCATGTAATTGAAAGTTGG - Intergenic
1202267187 Y:23032452-23032474 GTTTGCATATATTTGAAAACTGG + Intergenic
1202420179 Y:24666196-24666218 GTTTGCATATATTTGAAAACTGG + Intergenic
1202450607 Y:25003886-25003908 GTTTGCATATATTTGAAAACTGG - Intergenic