ID: 1055079494

View in Genome Browser
Species Human (GRCh38)
Location 9:72255226-72255248
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055079488_1055079494 4 Left 1055079488 9:72255199-72255221 CCTGCTTTCAATTACATGCAAAT No data
Right 1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type