ID: 1055079494 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:72255226-72255248 |
Sequence | GGGTGGGTGGATGCAAATTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055079488_1055079494 | 4 | Left | 1055079488 | 9:72255199-72255221 | CCTGCTTTCAATTACATGCAAAT | No data | ||
Right | 1055079494 | 9:72255226-72255248 | GGGTGGGTGGATGCAAATTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055079494 | Original CRISPR | GGGTGGGTGGATGCAAATTG AGG | Intronic | ||