ID: 1055080641

View in Genome Browser
Species Human (GRCh38)
Location 9:72265075-72265097
Sequence CTACCTCAGGGGAGATGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055080632_1055080641 14 Left 1055080632 9:72265038-72265060 CCTGCTTCAGAGGAAGGTCAGAG No data
Right 1055080641 9:72265075-72265097 CTACCTCAGGGGAGATGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055080641 Original CRISPR CTACCTCAGGGGAGATGGGT GGG Intergenic
No off target data available for this crispr