ID: 1055084024

View in Genome Browser
Species Human (GRCh38)
Location 9:72295800-72295822
Sequence ATAACATATTTGGCCATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055084024_1055084027 23 Left 1055084024 9:72295800-72295822 CCATATATGGCCAAATATGTTAT No data
Right 1055084027 9:72295846-72295868 ATCAAGTGGACACTGACAAATGG No data
1055084024_1055084026 9 Left 1055084024 9:72295800-72295822 CCATATATGGCCAAATATGTTAT No data
Right 1055084026 9:72295832-72295854 TTTAAAATTTATAAATCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055084024 Original CRISPR ATAACATATTTGGCCATATA TGG (reversed) Intergenic
No off target data available for this crispr