ID: 1055085449

View in Genome Browser
Species Human (GRCh38)
Location 9:72308994-72309016
Sequence AGGATATCTTCCTAAAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055085449_1055085452 1 Left 1055085449 9:72308994-72309016 CCATTGTTTTAGGAAGATATCCT No data
Right 1055085452 9:72309018-72309040 GAAAATAGGTTACTCAATATAGG No data
1055085449_1055085453 2 Left 1055085449 9:72308994-72309016 CCATTGTTTTAGGAAGATATCCT No data
Right 1055085453 9:72309019-72309041 AAAATAGGTTACTCAATATAGGG No data
1055085449_1055085455 13 Left 1055085449 9:72308994-72309016 CCATTGTTTTAGGAAGATATCCT No data
Right 1055085455 9:72309030-72309052 CTCAATATAGGGATGGACCAAGG No data
1055085449_1055085454 6 Left 1055085449 9:72308994-72309016 CCATTGTTTTAGGAAGATATCCT No data
Right 1055085454 9:72309023-72309045 TAGGTTACTCAATATAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055085449 Original CRISPR AGGATATCTTCCTAAAACAA TGG (reversed) Intergenic
No off target data available for this crispr