ID: 1055085451

View in Genome Browser
Species Human (GRCh38)
Location 9:72309014-72309036
Sequence TATTGAGTAACCTATTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055085451_1055085455 -7 Left 1055085451 9:72309014-72309036 CCTAGAAAATAGGTTACTCAATA No data
Right 1055085455 9:72309030-72309052 CTCAATATAGGGATGGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055085451 Original CRISPR TATTGAGTAACCTATTTTCT AGG (reversed) Intergenic
No off target data available for this crispr