ID: 1055085455

View in Genome Browser
Species Human (GRCh38)
Location 9:72309030-72309052
Sequence CTCAATATAGGGATGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055085449_1055085455 13 Left 1055085449 9:72308994-72309016 CCATTGTTTTAGGAAGATATCCT No data
Right 1055085455 9:72309030-72309052 CTCAATATAGGGATGGACCAAGG No data
1055085451_1055085455 -7 Left 1055085451 9:72309014-72309036 CCTAGAAAATAGGTTACTCAATA No data
Right 1055085455 9:72309030-72309052 CTCAATATAGGGATGGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055085455 Original CRISPR CTCAATATAGGGATGGACCA AGG Intergenic
No off target data available for this crispr