ID: 1055085472

View in Genome Browser
Species Human (GRCh38)
Location 9:72309248-72309270
Sequence AAAACAGATGTGCCCCCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055085472_1055085473 8 Left 1055085472 9:72309248-72309270 CCTCACGGGGGCACATCTGTTTT No data
Right 1055085473 9:72309279-72309301 GCAAACTCAAATGACTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055085472 Original CRISPR AAAACAGATGTGCCCCCGTG AGG (reversed) Intergenic
No off target data available for this crispr