ID: 1055086132

View in Genome Browser
Species Human (GRCh38)
Location 9:72315837-72315859
Sequence ATGTTCCCCTTTGATTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055086132_1055086136 13 Left 1055086132 9:72315837-72315859 CCACAGAAATCAAAGGGGAACAT No data
Right 1055086136 9:72315873-72315895 GCTGATCAACGTGTAAACAAAGG No data
1055086132_1055086138 15 Left 1055086132 9:72315837-72315859 CCACAGAAATCAAAGGGGAACAT No data
Right 1055086138 9:72315875-72315897 TGATCAACGTGTAAACAAAGGGG No data
1055086132_1055086137 14 Left 1055086132 9:72315837-72315859 CCACAGAAATCAAAGGGGAACAT No data
Right 1055086137 9:72315874-72315896 CTGATCAACGTGTAAACAAAGGG No data
1055086132_1055086139 30 Left 1055086132 9:72315837-72315859 CCACAGAAATCAAAGGGGAACAT No data
Right 1055086139 9:72315890-72315912 CAAAGGGGTAGTCAAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055086132 Original CRISPR ATGTTCCCCTTTGATTTCTG TGG (reversed) Intergenic
No off target data available for this crispr