ID: 1055086134

View in Genome Browser
Species Human (GRCh38)
Location 9:72315867-72315889
Sequence TTTACACGTTGATCAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055086134_1055086139 0 Left 1055086134 9:72315867-72315889 CCACCTGCTGATCAACGTGTAAA No data
Right 1055086139 9:72315890-72315912 CAAAGGGGTAGTCAAGACTGAGG No data
1055086134_1055086141 17 Left 1055086134 9:72315867-72315889 CCACCTGCTGATCAACGTGTAAA No data
Right 1055086141 9:72315907-72315929 CTGAGGAGGACCAGCTTTTGAGG No data
1055086134_1055086140 3 Left 1055086134 9:72315867-72315889 CCACCTGCTGATCAACGTGTAAA No data
Right 1055086140 9:72315893-72315915 AGGGGTAGTCAAGACTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055086134 Original CRISPR TTTACACGTTGATCAGCAGG TGG (reversed) Intergenic
No off target data available for this crispr