ID: 1055086135

View in Genome Browser
Species Human (GRCh38)
Location 9:72315870-72315892
Sequence TTGTTTACACGTTGATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055086135_1055086141 14 Left 1055086135 9:72315870-72315892 CCTGCTGATCAACGTGTAAACAA No data
Right 1055086141 9:72315907-72315929 CTGAGGAGGACCAGCTTTTGAGG No data
1055086135_1055086140 0 Left 1055086135 9:72315870-72315892 CCTGCTGATCAACGTGTAAACAA No data
Right 1055086140 9:72315893-72315915 AGGGGTAGTCAAGACTGAGGAGG No data
1055086135_1055086139 -3 Left 1055086135 9:72315870-72315892 CCTGCTGATCAACGTGTAAACAA No data
Right 1055086139 9:72315890-72315912 CAAAGGGGTAGTCAAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055086135 Original CRISPR TTGTTTACACGTTGATCAGC AGG (reversed) Intergenic
No off target data available for this crispr