ID: 1055086138

View in Genome Browser
Species Human (GRCh38)
Location 9:72315875-72315897
Sequence TGATCAACGTGTAAACAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055086126_1055086138 30 Left 1055086126 9:72315822-72315844 CCCGCTGCTCCTGAGCCACAGAA No data
Right 1055086138 9:72315875-72315897 TGATCAACGTGTAAACAAAGGGG No data
1055086129_1055086138 21 Left 1055086129 9:72315831-72315853 CCTGAGCCACAGAAATCAAAGGG No data
Right 1055086138 9:72315875-72315897 TGATCAACGTGTAAACAAAGGGG No data
1055086132_1055086138 15 Left 1055086132 9:72315837-72315859 CCACAGAAATCAAAGGGGAACAT No data
Right 1055086138 9:72315875-72315897 TGATCAACGTGTAAACAAAGGGG No data
1055086127_1055086138 29 Left 1055086127 9:72315823-72315845 CCGCTGCTCCTGAGCCACAGAAA No data
Right 1055086138 9:72315875-72315897 TGATCAACGTGTAAACAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055086138 Original CRISPR TGATCAACGTGTAAACAAAG GGG Intergenic
No off target data available for this crispr