ID: 1055086139

View in Genome Browser
Species Human (GRCh38)
Location 9:72315890-72315912
Sequence CAAAGGGGTAGTCAAGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055086132_1055086139 30 Left 1055086132 9:72315837-72315859 CCACAGAAATCAAAGGGGAACAT No data
Right 1055086139 9:72315890-72315912 CAAAGGGGTAGTCAAGACTGAGG No data
1055086134_1055086139 0 Left 1055086134 9:72315867-72315889 CCACCTGCTGATCAACGTGTAAA No data
Right 1055086139 9:72315890-72315912 CAAAGGGGTAGTCAAGACTGAGG No data
1055086135_1055086139 -3 Left 1055086135 9:72315870-72315892 CCTGCTGATCAACGTGTAAACAA No data
Right 1055086139 9:72315890-72315912 CAAAGGGGTAGTCAAGACTGAGG No data
1055086133_1055086139 3 Left 1055086133 9:72315864-72315886 CCACCACCTGCTGATCAACGTGT No data
Right 1055086139 9:72315890-72315912 CAAAGGGGTAGTCAAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055086139 Original CRISPR CAAAGGGGTAGTCAAGACTG AGG Intergenic
No off target data available for this crispr