ID: 1055090177

View in Genome Browser
Species Human (GRCh38)
Location 9:72356431-72356453
Sequence TCGATAGAGGGAGAGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055090177_1055090185 27 Left 1055090177 9:72356431-72356453 CCCAGATGCTCTCCCTCTATCGA 0: 1
1: 0
2: 0
3: 7
4: 194
Right 1055090185 9:72356481-72356503 TTTACACAGGCTCTGGAGTTAGG No data
1055090177_1055090183 14 Left 1055090177 9:72356431-72356453 CCCAGATGCTCTCCCTCTATCGA 0: 1
1: 0
2: 0
3: 7
4: 194
Right 1055090183 9:72356468-72356490 ACGCAGGATAAAATTTACACAGG No data
1055090177_1055090181 -2 Left 1055090177 9:72356431-72356453 CCCAGATGCTCTCCCTCTATCGA 0: 1
1: 0
2: 0
3: 7
4: 194
Right 1055090181 9:72356452-72356474 GACTCCTGTAGATGCAACGCAGG No data
1055090177_1055090184 20 Left 1055090177 9:72356431-72356453 CCCAGATGCTCTCCCTCTATCGA 0: 1
1: 0
2: 0
3: 7
4: 194
Right 1055090184 9:72356474-72356496 GATAAAATTTACACAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055090177 Original CRISPR TCGATAGAGGGAGAGCATCT GGG (reversed) Intronic
901672425 1:10863587-10863609 TTGAAAGAGGGAGAGCCCCTCGG + Intergenic
902750154 1:18502643-18502665 TCGGGAGAGGGAGACCATCCTGG + Intergenic
903788730 1:25878157-25878179 TCGAGAGATGGAGACCATCCTGG + Intergenic
904199200 1:28808477-28808499 TCAAGAGATGGAGACCATCTTGG + Intergenic
904283086 1:29435047-29435069 TCAGTAGATGGAGACCATCTTGG + Intergenic
905200548 1:36313111-36313133 TCAAGAGACGGAGACCATCTTGG + Intronic
906544110 1:46609454-46609476 TGGAGAAGGGGAGAGCATCTAGG - Exonic
908946169 1:69500027-69500049 TCAAGAGAGGGAGACCATCCTGG - Intergenic
912494440 1:110082479-110082501 TCATTACAGGGAGGGCATCTGGG - Intergenic
912546478 1:110455031-110455053 TCCAGAGAGGGAGAGCAGCAGGG - Intronic
913282525 1:117199843-117199865 TCAAGAGATGGAGACCATCTTGG - Intronic
913369099 1:118077269-118077291 TTGAAAGGGGGAGGGCATCTGGG - Intronic
915842118 1:159222276-159222298 TCGATAGAAGGAGAGCATAGAGG + Intergenic
918848489 1:189650748-189650770 TCAAGAGATCGAGAGCATCTTGG + Intergenic
919257696 1:195144709-195144731 TCAAGAGATGGAGAGCATCCTGG - Intergenic
921229974 1:213059880-213059902 TCAATAGATGGAGACCATCCTGG - Intronic
921315439 1:213886098-213886120 AAGAGATAGGGAGAGCATCTTGG - Intergenic
923346551 1:233058872-233058894 TCGAGAGAGCGAGACCATCCTGG - Intronic
1063097723 10:2922953-2922975 TCAAGAGATGGAGACCATCTTGG + Intergenic
1067406852 10:46031053-46031075 TCGGAAGATGGAGAGCATCCTGG + Intergenic
1069587730 10:69619734-69619756 TGGAAAGATGGAGATCATCTTGG - Intergenic
1072794185 10:98341847-98341869 TCAAGAGATGGAGACCATCTTGG - Intergenic
1073377707 10:103050996-103051018 GGGATAGAGAAAGAGCATCTGGG + Intronic
1073391274 10:103178619-103178641 TCAAGAGATGGAGACCATCTTGG + Intronic
1074458690 10:113617206-113617228 GGGAAGGAGGGAGAGCATCTTGG + Intronic
1076558480 10:131345673-131345695 ACGATGGAGGAAGGGCATCTTGG + Intergenic
1081197768 11:40182005-40182027 GAGAGAGAGGGAGAGCATCAAGG - Intronic
1081788641 11:45767041-45767063 TCGGGAGAAGGGGAGCATCTTGG - Intergenic
1082046343 11:47732008-47732030 TAAAGAGAGGGAGAGGATCTGGG + Intronic
1083746135 11:64737457-64737479 TCAAGAGATGGAGACCATCTTGG + Intronic
1083942578 11:65904859-65904881 TCAAGAGATCGAGAGCATCTTGG - Intergenic
1085888780 11:80552724-80552746 TCTAGAGATGGAGAGCATCCTGG - Intergenic
1086404071 11:86485434-86485456 TTAATAGAGGCATAGCATCTAGG - Intronic
1088262772 11:107959998-107960020 TCAAGAGATCGAGAGCATCTTGG + Intronic
1089582337 11:119489276-119489298 TTGAGAGAGGAAGAGGATCTGGG + Intergenic
1090288636 11:125522281-125522303 TCAAGAGATGGAGACCATCTTGG + Intergenic
1090604119 11:128403746-128403768 TGGCTATAGGGAGAGTATCTTGG - Intergenic
1090852491 11:130582810-130582832 TCAAGAGATGGAGACCATCTTGG + Intergenic
1090962418 11:131568876-131568898 AAGAGAGAGAGAGAGCATCTGGG - Intronic
1091071098 11:132564221-132564243 GTAATAGAGGGAGAGTATCTTGG - Intronic
1091939316 12:4462250-4462272 TCAAGAGATGGAGACCATCTTGG + Intergenic
1092912490 12:13159685-13159707 TCAAGAGATGGAGACCATCTTGG + Intergenic
1093139479 12:15491201-15491223 TCTCTTGAGGGAGAGGATCTGGG - Intronic
1095558298 12:43534906-43534928 TAGGTAGAGGGACAGCATGTTGG - Intronic
1096487479 12:51993551-51993573 TCGAGAGAGCGAGACCATCCTGG + Intronic
1096702704 12:53396356-53396378 TCAAGAGATGGAGAGCATCCTGG + Intronic
1096981700 12:55731575-55731597 TCAATAGATGGAGACCATCCTGG - Intergenic
1097511708 12:60550311-60550333 TCAAGAGATGGAGACCATCTTGG - Intergenic
1098557234 12:71833256-71833278 TCGAGAGATGGAGACCATCCTGG - Intergenic
1098958579 12:76714220-76714242 TTGAGATAGGGAGATCATCTGGG - Intergenic
1100429509 12:94518023-94518045 TCAAGAGATGGAGAGCATCCTGG + Intergenic
1103245165 12:119450645-119450667 TCAAGAGATGGAGACCATCTTGG + Intronic
1104740263 12:131166793-131166815 TTGAGATAGGGAGAGCATCCTGG + Intergenic
1104791961 12:131488672-131488694 TTGAGATAGGGAGAGCATCCTGG - Intergenic
1107527790 13:41250352-41250374 TCTATAGAGAGAGAGCATTCAGG - Intronic
1109240406 13:59879945-59879967 TAGATAGAGGGAGAGTAAATAGG + Intronic
1109919468 13:69036768-69036790 TCGAGAGATCGAGACCATCTTGG - Intergenic
1112079874 13:95958360-95958382 TCGAGAGATGGAGACCATCCAGG - Intronic
1119953865 14:78774009-78774031 TCCAGAGATGGAGACCATCTTGG - Intronic
1120972675 14:90221358-90221380 TCGATGCAGGAAGAGCATTTTGG + Intergenic
1122224711 14:100267731-100267753 TCGAGAGATCGAGACCATCTTGG - Intronic
1122527664 14:102399617-102399639 TCAAGAGATGGAGACCATCTTGG + Intronic
1125834649 15:42738217-42738239 TCGAGAGATGGAGACCATCCTGG + Intergenic
1127717076 15:61659099-61659121 TGGCTAGAGGGAGGGCCTCTGGG - Intergenic
1133645573 16:7761252-7761274 TCAAAAGAGCGAGAGCATCCTGG - Intergenic
1138069128 16:53973256-53973278 CCGACAAGGGGAGAGCATCTGGG - Intronic
1138968164 16:62111154-62111176 TAGGGGGAGGGAGAGCATCTGGG - Intergenic
1140162714 16:72515167-72515189 TGGAGGGAGGGAGAGCATCAAGG - Intergenic
1144158739 17:12535767-12535789 TCAAGAGATGGAGACCATCTTGG + Intergenic
1144318645 17:14090117-14090139 TAGATAGAGGGAGATCTGCTTGG - Intronic
1145893538 17:28436594-28436616 TCGAGAGATGGAGACCATCCTGG - Intergenic
1147283606 17:39382943-39382965 TCAAGAGATGGAGACCATCTTGG + Intronic
1147344944 17:39784611-39784633 TCAAGAGATGGAGACCATCTTGG - Intronic
1147660808 17:42115933-42115955 TAGAGAGAGCGAGAGCATCCAGG + Intronic
1150045500 17:61909318-61909340 TCAAGAGAGGGAGACCATCCTGG - Intronic
1152833756 17:82515945-82515967 TCAATAGATGGAGACCATCCTGG - Intergenic
1156004045 18:32419282-32419304 TCCATGGAGGGAGACTATCTTGG - Intronic
1161938995 19:7390828-7390850 TCAAGAGAGGGAGACCATCCTGG + Intronic
1163147297 19:15389001-15389023 TCAAGAGATGGAGACCATCTTGG + Intronic
1164874967 19:31678169-31678191 TCAAGAGATCGAGAGCATCTTGG + Intergenic
1165665150 19:37621805-37621827 TCCAGAGAGGGAGTGCATTTTGG + Intronic
1167315189 19:48758673-48758695 TCAAGAGATGGAGAGCATCCTGG - Intergenic
925444319 2:3914876-3914898 TCTATAGAGGGGGAGGAACTGGG + Intergenic
929256415 2:39815743-39815765 TCGGGTGAGGGAGAGCATCAGGG + Intergenic
930753680 2:54955281-54955303 ATGATAGACAGAGAGCATCTTGG + Intronic
931330712 2:61279673-61279695 TCAAAAGATGGAGACCATCTTGG - Intronic
931760413 2:65411914-65411936 TCAATAGACGGAGACCATCCTGG + Intronic
932893059 2:75612590-75612612 TTGATATAGGGAGAACATTTGGG - Intergenic
933190461 2:79328286-79328308 GCAAAAGAGAGAGAGCATCTGGG + Intronic
935714776 2:105930324-105930346 TCTAGAGAGGGAGAGGACCTGGG + Intergenic
935862431 2:107347651-107347673 TCAAGAGATGGAGACCATCTTGG - Intergenic
936598745 2:113874889-113874911 TCAAGAGATGGAGACCATCTTGG + Intergenic
937281179 2:120718269-120718291 TCGAGCTAGGGAGAGCATCCTGG - Intergenic
938998460 2:136705811-136705833 TTGAGAGAGGGAGACTATCTTGG + Intergenic
940340354 2:152574224-152574246 TCAAGAGATGGAGAGCATCCTGG + Intronic
940943015 2:159584329-159584351 TCAAGAGATGGAGACCATCTTGG - Intronic
944705400 2:202283648-202283670 TCAATAGATCGAGACCATCTTGG - Intronic
945917751 2:215721893-215721915 TCGGGGGAGGGAGAGCATCAGGG + Intergenic
945973365 2:216251936-216251958 TCAAGAGATGGAGACCATCTTGG - Intergenic
946246976 2:218393327-218393349 GTGACAGAGGGAGACCATCTGGG - Intronic
946806460 2:223475700-223475722 TAGCAAGAGGGAGAGCAACTGGG + Intergenic
947548064 2:231025974-231025996 TCAATAGATTGAGAGCATCCCGG - Intergenic
1169236920 20:3937046-3937068 TCAAGAGATCGAGAGCATCTTGG - Intronic
1169350555 20:4864797-4864819 TCGCTAGTGGAAGAGCATCCAGG + Intronic
1174816861 20:53694565-53694587 TCGATAGTTGGAGACCATCCTGG - Intergenic
1174910889 20:54606355-54606377 TGGATACAGGAAGAGCATCCAGG + Intronic
1176101798 20:63367790-63367812 TCGGGAGAGGGAGCGCATCTCGG + Intronic
1178342325 21:31796419-31796441 TCAAGAGATGGAGAGCATCCTGG + Intergenic
1178395336 21:32237948-32237970 CAGAAAGATGGAGAGCATCTGGG - Intergenic
1179255448 21:39711742-39711764 TCGAGAGATCGAGACCATCTTGG - Intergenic
1182749502 22:32630191-32630213 TCAAGAGATGGAGATCATCTTGG - Intronic
1182869444 22:33633297-33633319 ACGATGCAGGGAGAGCATCTTGG + Intronic
1182884777 22:33764057-33764079 TCGAGAGATTGAGACCATCTTGG - Intronic
1184661776 22:45968790-45968812 TCCATAGAGGGTGTGCATGTGGG - Intronic
949591231 3:5496344-5496366 TCGATAGATGGACTCCATCTGGG + Intergenic
949842859 3:8339078-8339100 TAGTTAGTGGGACAGCATCTGGG - Intergenic
953163838 3:40446473-40446495 TCGAAGGAGGGAGACCATGTAGG + Intergenic
955260950 3:57390043-57390065 TCAAGAGATGGAGAGCATCCTGG - Intronic
957131541 3:76229004-76229026 TTAAGAGAGGGAGAGGATCTCGG - Intronic
961406633 3:126684326-126684348 TGGATGGAGGGAGAGCAGGTGGG + Intergenic
963110790 3:141686246-141686268 ATGAGAGAGGGAGATCATCTTGG + Intergenic
964348366 3:155777938-155777960 TCAATAGATGGAGACCATCCTGG + Intronic
964435717 3:156650685-156650707 TCAAGAGATGGAGACCATCTTGG - Intergenic
964740985 3:159965771-159965793 TCAAGAGATGGAGACCATCTTGG - Intergenic
964937664 3:162111640-162111662 TTGGTAAAGGGAGAACATCTTGG + Intergenic
966939632 3:184737411-184737433 TTGAGAGAGGGAGAGCGTCAGGG + Intergenic
967433670 3:189419147-189419169 ACGAGAGAGGGACAGCATCTTGG - Intergenic
969178963 4:5422902-5422924 ACGATAGAGAGAGGGCATTTAGG + Intronic
970709855 4:18849224-18849246 TCGAGAGATTGAGACCATCTTGG - Intergenic
970791123 4:19859344-19859366 TGGGAGGAGGGAGAGCATCTGGG - Intergenic
971575394 4:28266473-28266495 TCCATAGAGAGAGAACAACTGGG + Intergenic
972497310 4:39646015-39646037 TCAAGAGAGGGAGACCATCCTGG + Intergenic
972748416 4:41964219-41964241 TCGAGAGATCGAGATCATCTTGG - Intergenic
974049500 4:56927194-56927216 TAGATAGAGCTAGACCATCTGGG - Intronic
974225004 4:59029628-59029650 TATATAGAGAGAGAGCATATGGG + Intergenic
976017662 4:80577610-80577632 TCAATAGATGGAGACCATCCTGG - Intronic
976260540 4:83140956-83140978 TCAAGAGATGGAGACCATCTGGG + Intergenic
977096356 4:92749522-92749544 TCAAGAGATGGAGACCATCTTGG - Intronic
979430350 4:120622168-120622190 TCAAGAGATGGAGACCATCTTGG - Intergenic
980082422 4:128358106-128358128 TCACCAGAGGCAGAGCATCTGGG + Intergenic
980824581 4:138058069-138058091 TCGATAGACTGAGATCATCCTGG - Intergenic
982525631 4:156474242-156474264 TAGAGGGAGGGAGAGCATCAGGG + Intergenic
982760832 4:159281199-159281221 TCAAAAGAGCGAGACCATCTTGG - Intronic
983831346 4:172331534-172331556 TGGATAGAGGGACAGGAGCTGGG - Intronic
984154717 4:176181255-176181277 TCGGTAGATGGAGACCATCCTGG + Intronic
987524326 5:19028881-19028903 TCGGCAGATGGAGACCATCTTGG + Intergenic
990369585 5:55103794-55103816 TCAAGAGATGGAGACCATCTTGG + Intronic
995728346 5:115206749-115206771 TCTATAGATAGAGAGTATCTGGG + Intergenic
1000664767 5:163981068-163981090 TCCATAGTGGGAGAACATTTTGG - Intergenic
1001382620 5:171314407-171314429 TCAAGAGATGGAGACCATCTTGG - Intergenic
1002119229 5:176988891-176988913 TCGAGAGATCGAGACCATCTTGG - Intronic
1003458994 6:6312458-6312480 TCAAGAGATGGAGACCATCTTGG + Intronic
1004031510 6:11874475-11874497 CAGAGTGAGGGAGAGCATCTGGG + Intergenic
1008322258 6:50130847-50130869 TCGAAAGAGTAAGACCATCTGGG - Intergenic
1009512000 6:64564490-64564512 TCAAGAGAGGGAGACCATCCTGG - Intronic
1009666959 6:66694770-66694792 TCAAGAGATGGAGACCATCTTGG + Intergenic
1012228236 6:96729738-96729760 TTGAGAGAGGGAGATAATCTAGG + Intergenic
1013143884 6:107368057-107368079 TCAAGAGATGGAGACCATCTTGG + Intronic
1015934183 6:138391811-138391833 TCAAGAGATGGAGATCATCTTGG - Intergenic
1016002750 6:139058811-139058833 TCGAGAGATTGAGACCATCTTGG - Intergenic
1018112644 6:160550009-160550031 TCAACAGAGCGAGACCATCTTGG + Intronic
1020142921 7:5622340-5622362 TGGATGGGGGGACAGCATCTTGG + Intronic
1020145732 7:5641253-5641275 TCGACAGAGGTAGCACATCTGGG + Exonic
1027267624 7:76502967-76502989 CCGATGCAGGGAGAGCAGCTGGG - Intronic
1027319437 7:77002832-77002854 CCGATGCAGGGAGAGCAGCTGGG - Intergenic
1027964353 7:84986935-84986957 TCAAGAGAGGGAGACCATCCTGG + Intergenic
1029892726 7:103948461-103948483 TCAATAGATGGAGACCATCCTGG + Intronic
1030498733 7:110332596-110332618 TCCATAGAGGCTGAGCATGTTGG - Intergenic
1033727224 7:144131793-144131815 TCGGGAGATGGAGACCATCTCGG - Intergenic
1034464737 7:151220178-151220200 TCAAGAGAGGGAGACCATCCTGG + Intronic
1035059456 7:156058353-156058375 TCGAGAGATGGAGACCATCCTGG - Intergenic
1035483423 7:159204103-159204125 ACGATGGAGGGAGAGGAGCTGGG - Intergenic
1040463182 8:47669788-47669810 TCAAGAGATGGAGACCATCTTGG + Intronic
1043632538 8:82354336-82354358 TCAAAAGATGGAGACCATCTTGG - Intergenic
1044166899 8:88995897-88995919 TCAAGAGATTGAGAGCATCTGGG - Intergenic
1044652807 8:94515884-94515906 TCGACAGATGGAGACCATCCTGG + Intronic
1045948895 8:107829487-107829509 TCAAGAGATGGAGATCATCTTGG + Intergenic
1046447854 8:114346743-114346765 TCAAGAGATTGAGAGCATCTTGG + Intergenic
1047780482 8:128106861-128106883 TCAAGAGAGGGAGACCATCCTGG + Intergenic
1048812417 8:138300959-138300981 TCGAGAGATGGAGACCATCCTGG - Intronic
1049897172 9:118862-118884 TTGAGTCAGGGAGAGCATCTTGG - Intergenic
1051015602 9:12471672-12471694 TCAAGAGATGGAGAGCATCTTGG - Intergenic
1054443237 9:65285120-65285142 TTGAGTCAGGGAGAGCATCTTGG - Exonic
1054487043 9:65736381-65736403 TTGAGTCAGGGAGAGCATCTTGG + Intergenic
1055090177 9:72356431-72356453 TCGATAGAGGGAGAGCATCTGGG - Intronic
1057886926 9:98836842-98836864 CCGATGGAGGCTGAGCATCTTGG + Intronic
1059029150 9:110671179-110671201 TCAAGAGATGGAGACCATCTTGG - Intronic
1060836349 9:126757923-126757945 TCAAGAGATGGAGACCATCTTGG - Intergenic
1061985120 9:134126137-134126159 TCAAGAGATGGAGACCATCTTGG + Intergenic
1186384051 X:9091437-9091459 TTGATAGAGGAAGAGAAACTAGG - Intronic
1188891390 X:35615063-35615085 TCAAGAGATGGAGACCATCTTGG + Intergenic
1190179063 X:48176117-48176139 TCAAGAGATGGAGACCATCTTGG + Intergenic
1194156437 X:90394841-90394863 TCAAGAGATGGAGACCATCTTGG - Intergenic
1194720395 X:97333920-97333942 TGGACATAGGGAGAGCATCTGGG - Intronic
1195190049 X:102440578-102440600 TCAAGAGAGGGAGACCATCCTGG - Intronic
1195333864 X:103830985-103831007 TCGATAGGGGAAGAGCAACTGGG + Intronic
1196075197 X:111568538-111568560 CCACTAGAGGGAGAGCATCCTGG - Intergenic
1196826214 X:119742342-119742364 TCAAGAGATGGAGACCATCTTGG + Intergenic
1197662989 X:129193921-129193943 TTGATAGAGCCAGAGCATTTGGG + Intergenic
1197907828 X:131445108-131445130 TAGATGGAGGGAGAGGATCAGGG + Intergenic
1198829118 X:140730084-140730106 TCAAGAGATGGAGACCATCTTGG - Intergenic
1200502786 Y:3971830-3971852 TCAAGAGATGGAGACCATCTTGG - Intergenic