ID: 1055090178

View in Genome Browser
Species Human (GRCh38)
Location 9:72356432-72356454
Sequence GTCGATAGAGGGAGAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 968
Summary {0: 1, 1: 0, 2: 1, 3: 122, 4: 844}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055090178_1055090183 13 Left 1055090178 9:72356432-72356454 CCAGATGCTCTCCCTCTATCGAC 0: 1
1: 0
2: 1
3: 122
4: 844
Right 1055090183 9:72356468-72356490 ACGCAGGATAAAATTTACACAGG No data
1055090178_1055090184 19 Left 1055090178 9:72356432-72356454 CCAGATGCTCTCCCTCTATCGAC 0: 1
1: 0
2: 1
3: 122
4: 844
Right 1055090184 9:72356474-72356496 GATAAAATTTACACAGGCTCTGG No data
1055090178_1055090181 -3 Left 1055090178 9:72356432-72356454 CCAGATGCTCTCCCTCTATCGAC 0: 1
1: 0
2: 1
3: 122
4: 844
Right 1055090181 9:72356452-72356474 GACTCCTGTAGATGCAACGCAGG No data
1055090178_1055090185 26 Left 1055090178 9:72356432-72356454 CCAGATGCTCTCCCTCTATCGAC 0: 1
1: 0
2: 1
3: 122
4: 844
Right 1055090185 9:72356481-72356503 TTTACACAGGCTCTGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055090178 Original CRISPR GTCGATAGAGGGAGAGCATC TGG (reversed) Intronic
900225465 1:1531240-1531262 GTCAAGAGATGGAGACCATCTGG + Intronic
903023149 1:20408502-20408524 GTGGGGAGAGGGAGAACATCAGG + Intergenic
904596066 1:31646293-31646315 GTGGGAAGAGGGAGAGCATCAGG - Intergenic
905962287 1:42053431-42053453 GTGGGGAGAGGGAGAGCATTAGG - Intergenic
907612898 1:55890342-55890364 GTGAATGGAGGGAGAGGATCAGG - Intergenic
907854346 1:58287167-58287189 CTGGAGGGAGGGAGAGCATCAGG + Intronic
908837392 1:68241529-68241551 GTGGGTGGAGGGAGAGGATCAGG + Intergenic
908879489 1:68714609-68714631 GTTGGGAGAAGGAGAGCATCAGG + Intergenic
909046984 1:70722363-70722385 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
909224922 1:73007071-73007093 GTGGTGGGAGGGAGAGCATCAGG + Intergenic
909268108 1:73588400-73588422 GTGGAGGGAGGGAGGGCATCAGG - Intergenic
909461223 1:75916695-75916717 GATGGAAGAGGGAGAGCATCAGG + Intergenic
910009546 1:82444260-82444282 GTGGGCAGAGGGAGAGCATCAGG - Intergenic
910438591 1:87229797-87229819 GGCGGGGGAGGGAGAGCATCAGG - Intergenic
910441167 1:87253435-87253457 GGAGAGGGAGGGAGAGCATCAGG - Intergenic
910642517 1:89479289-89479311 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
910810237 1:91228259-91228281 GTGAAGGGAGGGAGAGCATCAGG - Intergenic
910892857 1:92035750-92035772 GTGGGGAGAGGGAGAGCATCAGG - Intronic
911536763 1:99109053-99109075 GGGGTGAGAGGGAGAGCATCAGG + Intergenic
911667854 1:100574392-100574414 GTGGGAAGAGGGAGAGAATCAGG + Intergenic
911744920 1:101430885-101430907 GTGGGGAGAGGGAGAGCATCAGG - Intergenic
911843005 1:102708340-102708362 GTCGGGGGAGGGAGAGAATCCGG + Intergenic
911896828 1:103446576-103446598 GTCTGGGGAGGGAGAGCATCAGG + Intergenic
912117234 1:106421584-106421606 GTGGCGGGAGGGAGAGCATCAGG + Intergenic
912494441 1:110082480-110082502 GTCATTACAGGGAGGGCATCTGG - Intergenic
912546479 1:110455032-110455054 CTCCAGAGAGGGAGAGCAGCAGG - Intronic
912887839 1:113494366-113494388 GTGGGAAGAGGGAGAGAATCAGG + Intronic
913423328 1:118697582-118697604 GTTGGGAGAGGGATAGCATCAGG + Intergenic
913542117 1:119831410-119831432 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
915175952 1:154015192-154015214 ATGGAGGGAGGGAGAGCATCAGG - Intronic
915389507 1:155528831-155528853 GTGGGAAGAGGGAGAGAATCAGG - Intronic
915692841 1:157707326-157707348 GTGGGAAGAGAGAGAGCATCAGG + Intergenic
915851705 1:159330872-159330894 GTCAGGTGAGGGAGAGCATCAGG + Intergenic
916000686 1:160612385-160612407 GTGGGAAGAGGGAGAGGATCAGG - Intronic
916068766 1:161157749-161157771 GTGGCGGGAGGGAGAGCATCAGG + Intronic
916286805 1:163115152-163115174 GTTGAGGGAGGGAGAGCATTAGG + Intronic
916535667 1:165700898-165700920 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
916601061 1:166294012-166294034 GTCGGGGGAGGGAGAGCATCAGG + Intergenic
916979467 1:170117366-170117388 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
917290447 1:173467131-173467153 ATGGGAAGAGGGAGAGCATCAGG + Intergenic
917295658 1:173516444-173516466 GTGGAAGGAGGGAGAGAATCAGG - Intronic
917831678 1:178896598-178896620 GTCGGGGGAGGGATAGCATCGGG - Intronic
917994498 1:180421154-180421176 GTAGGGGGAGGGAGAGCATCAGG - Intronic
918420627 1:184361112-184361134 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
918798044 1:188930816-188930838 GTGGAAGGAGGGAGAGAATCAGG + Intergenic
918849213 1:189663369-189663391 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
918857549 1:189778407-189778429 GTTGGAGGAGGGAGAGCATCAGG + Intergenic
919062128 1:192646630-192646652 GTGGGAGGAGGGAGAGCATCAGG - Intronic
920981398 1:210839437-210839459 GTGGGAAGAGGGAGAGAATCAGG + Intronic
921774407 1:219080586-219080608 CTCCTTAGAGGGAGACCATCTGG + Intergenic
921783338 1:219195828-219195850 GCGGTGAGAGGGAGAGCATCAGG - Intronic
921800245 1:219394762-219394784 GTGGGAAGAGGGAGAGTATCAGG - Intergenic
922071530 1:222199297-222199319 GTCGGAGGAGGGAGAGGATCAGG - Intergenic
922138720 1:222859340-222859362 GTCGGGGGAGGGAGAGCATTAGG + Intergenic
922360167 1:224813948-224813970 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
923081630 1:230662168-230662190 GTGGAAGGAGGGAGAGCATATGG - Intronic
924764578 1:247020519-247020541 GTGGAGAGAGGGAGAACATCAGG - Intergenic
1063557293 10:7092918-7092940 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1063669723 10:8090362-8090384 GTTGAGGGAGGGAGAGCATTAGG - Intergenic
1063731171 10:8698869-8698891 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1064497776 10:15932124-15932146 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1064510243 10:16082190-16082212 GTTGGGGGAGGGAGAGCATCAGG + Intergenic
1064657571 10:17570969-17570991 GTGGAGGGAGGGAGAGCATTAGG + Intergenic
1065181571 10:23131358-23131380 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1065275049 10:24077319-24077341 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1065372567 10:25003807-25003829 GTGGAAGGAGGGAGAGGATCAGG - Intronic
1065758411 10:28957304-28957326 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1065791559 10:29265042-29265064 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1065937076 10:30530109-30530131 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1065975497 10:30838262-30838284 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1066173616 10:32879692-32879714 GTTGGGGGAGGGAGAGCATCAGG - Intronic
1066471884 10:35706603-35706625 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1066551839 10:36567543-36567565 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1067732870 10:48825093-48825115 GTGGGGAGAGGGAGAGCATTAGG - Intronic
1068025480 10:51637776-51637798 GTGGAAGGAGTGAGAGCATCAGG + Intronic
1068073090 10:52220548-52220570 GTAGGGAGAGGGAGAGAATCAGG - Intronic
1068116896 10:52745969-52745991 GTGGGAAGAGGGAGAGCATCAGG - Intergenic
1068185975 10:53587281-53587303 GTGGAAAGAGGGAGAGAATCGGG - Intergenic
1068653294 10:59547639-59547661 GTCAATAGATCGAGACCATCTGG + Intergenic
1068914198 10:62410509-62410531 GGGGAGGGAGGGAGAGCATCAGG - Intronic
1069361166 10:67643321-67643343 GTGGGAGGAGGGAGAGCATCAGG + Intronic
1069973484 10:72193553-72193575 GACTATAAAGGGAGAGCATGAGG + Intronic
1070293054 10:75134192-75134214 GCCGGGAGAGGGAGAACATCAGG + Intronic
1070452433 10:76575162-76575184 GTGGGGTGAGGGAGAGCATCAGG - Intergenic
1070869368 10:79736695-79736717 TTGGGAAGAGGGAGAGCATCAGG - Intergenic
1071060265 10:81561889-81561911 GTTGATAGAGGGAGAGGAGCAGG - Intergenic
1071141361 10:82513091-82513113 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1071237803 10:83669491-83669513 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1071636287 10:87258901-87258923 TTGGGAAGAGGGAGAGCATCAGG - Intergenic
1071658954 10:87479050-87479072 TTGGGAAGAGGGAGAGCATCAGG + Intergenic
1071795350 10:88998941-88998963 GTCGAGAGATTGAGACCATCTGG + Intronic
1071839680 10:89456682-89456704 GTGGGAAGAGGGAGAGCATCAGG - Intronic
1072365589 10:94705366-94705388 GTTGGTGGAGGGAGAGCATTAGG + Intronic
1073302409 10:102479173-102479195 GTGGAAAGAGGAAGAGCAGCAGG - Intergenic
1073500763 10:103934790-103934812 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1073659783 10:105462293-105462315 TTTGGGAGAGGGAGAGCATCAGG - Intergenic
1073916444 10:108410050-108410072 GTGGAGGGAGGAAGAGCATCAGG - Intergenic
1073948271 10:108777518-108777540 GTAGAGGGAGGGAGAGCATCAGG - Intergenic
1073989882 10:109250808-109250830 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1074062412 10:109979106-109979128 GCCTGTAGAGGGAGAGCATCAGG + Intergenic
1074627828 10:115212857-115212879 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1075304897 10:121359138-121359160 GTGGGGAGAGGGAGGGCATCAGG - Intergenic
1076095248 10:127729379-127729401 GTCAATGGAGGGAGAGCATTAGG - Intergenic
1077396201 11:2323844-2323866 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1077942824 11:6861763-6861785 GTGGAAGGAGGGAGAGAATCAGG + Intergenic
1078630215 11:12995831-12995853 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1078645594 11:13139060-13139082 GGGGGCAGAGGGAGAGCATCAGG - Intergenic
1079597382 11:22267747-22267769 GTCAGAAGAGGGAGAGGATCAGG - Intronic
1079611243 11:22435282-22435304 GTTGGGGGAGGGAGAGCATCAGG + Intergenic
1079938337 11:26645710-26645732 GCAGAGGGAGGGAGAGCATCAGG + Intronic
1080293107 11:30693475-30693497 GTGGAGGGAGGGAGAGCATCAGG + Intergenic
1080369613 11:31619798-31619820 GTGGGAAGAGGGAGAGGATCAGG - Intronic
1080513140 11:32995159-32995181 GTGAAAGGAGGGAGAGCATCAGG - Intergenic
1080721411 11:34852775-34852797 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1081403703 11:42671342-42671364 GTCGGGGGAGGGAGAGCATTAGG + Intergenic
1081624860 11:44647249-44647271 GTCGGGAGTGGGAGAGCATCAGG - Intergenic
1082677876 11:56130898-56130920 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1082913587 11:58405608-58405630 GTAGGAGGAGGGAGAGCATCAGG + Intergenic
1083063776 11:59901743-59901765 GTACCTAAAGGGAGAGCATCAGG + Intergenic
1083536456 11:63472050-63472072 GTTGGAGGAGGGAGAGCATCAGG + Intronic
1084984717 11:72858626-72858648 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1085177207 11:74500232-74500254 GTGGGGAGACGGAGAGCATCAGG - Intronic
1085327657 11:75619487-75619509 GTGGGAAGAGGGAGAGGATCAGG - Intronic
1085710183 11:78822577-78822599 GTGGGTAGAGGGAGAGTATCAGG + Intronic
1085929974 11:81070254-81070276 GTCAAGAGATGGAGACCATCTGG + Intergenic
1085946634 11:81280418-81280440 GGCGGTGGAGGGAGAGTATCAGG - Intergenic
1086185894 11:84015515-84015537 GTGGAAAAAGGGAGAGCATCAGG - Intronic
1086280271 11:85177527-85177549 GCAGAGTGAGGGAGAGCATCAGG + Intronic
1087097881 11:94337349-94337371 GTTGGGAGAGGGGGAGCATCAGG + Intergenic
1087332621 11:96800134-96800156 GTAGAAGGAGGGAGAGGATCAGG - Intergenic
1087436421 11:98124552-98124574 GTGGAAAGAGGGAGAGGATCAGG - Intergenic
1087556660 11:99729909-99729931 GTACAGAGAGGGAGAGCATTAGG + Intronic
1087719823 11:101650274-101650296 GTGGAAGGAGGGAGAACATCAGG + Intronic
1087730859 11:101777245-101777267 GCACAGAGAGGGAGAGCATCAGG + Intronic
1087747010 11:101959363-101959385 GTCAAGAGATGGAGACCATCTGG - Intronic
1087919856 11:103854372-103854394 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1088150758 11:106742320-106742342 GTGGAATGAGGGAGAGCATCAGG - Intronic
1088161629 11:106878637-106878659 GTGGGAAGAGGGAGAGGATCTGG + Intronic
1088201336 11:107338546-107338568 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1088362663 11:109007327-109007349 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1088385149 11:109246063-109246085 GCCGGGGGAGGGAGAGCATCAGG + Intergenic
1088532928 11:110830173-110830195 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
1088552809 11:111031262-111031284 GTGGAAGGAGGGAGAGAATCAGG + Intergenic
1088776353 11:113087648-113087670 CTCGATAGAGGGTGAGTATGAGG + Intronic
1089002410 11:115063060-115063082 GTGGGGAGAGGCAGAGCATCAGG - Intergenic
1089893197 11:121901685-121901707 GTCGGGGGAGGGAGAGCATCAGG + Intergenic
1089939638 11:122402243-122402265 GCGGGGAGAGGGAGAGCATCAGG + Intergenic
1090145909 11:124322297-124322319 ATTTGTAGAGGGAGAGCATCAGG - Intergenic
1090567627 11:128012603-128012625 GTTGAGAGAGGGAGAGCATCAGG + Intergenic
1090718812 11:129454111-129454133 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1091169711 11:133509204-133509226 GGGGGTTGAGGGAGAGCATCAGG - Intronic
1091699115 12:2648488-2648510 TACCATAGAGGGAGAGCATTGGG - Exonic
1092319919 12:7461039-7461061 GTGGGAAGAGGGAGAGGATCAGG - Intronic
1092511032 12:9157066-9157088 GTGCGGAGAGGGAGAGCATCAGG - Intronic
1092969262 12:13676197-13676219 GTGGGGAGAGGGAGAGCATCAGG + Intronic
1093189106 12:16054836-16054858 GTAGGAGGAGGGAGAGCATCAGG + Intergenic
1093357719 12:18189091-18189113 GTAAGGAGAGGGAGAGCATCAGG + Intronic
1093415804 12:18919146-18919168 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1093588766 12:20873746-20873768 GCAGAAGGAGGGAGAGCATCAGG - Intronic
1094206502 12:27845728-27845750 GCCGGGGGAGGGAGAGCATCAGG - Intergenic
1094262290 12:28514877-28514899 GTGGGAAGAGGGAGAGGATCAGG + Intronic
1094310870 12:29081005-29081027 GAGGGGAGAGGGAGAGCATCAGG + Intergenic
1095302944 12:40608566-40608588 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1095314550 12:40744143-40744165 GTAGAGGGAGGGAAAGCATCAGG + Intronic
1095323495 12:40858986-40859008 GTTGGGGGAGGGAGAGCATCAGG + Intronic
1095398953 12:41792584-41792606 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1095567838 12:43647289-43647311 GTCGAGAGATCGAGACCATCTGG - Intergenic
1095734475 12:45541667-45541689 GTCGGGGGAGGGATAGCATCAGG - Intergenic
1095853540 12:46836228-46836250 GTGGAATGAGGGAGAGAATCAGG - Intergenic
1097367813 12:58739620-58739642 GTCGGGGGAGGGAGAGCATTGGG - Intronic
1097635938 12:62122080-62122102 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1097932444 12:65204312-65204334 GTGGGGTGAGGGAGAGCATCAGG - Intronic
1098076739 12:66739592-66739614 GACAGGAGAGGGAGAGCATCAGG + Intronic
1098201289 12:68058654-68058676 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
1098263723 12:68697478-68697500 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1098410600 12:70179475-70179497 GTAGGGGGAGGGAGAGCATCAGG - Intergenic
1098512978 12:71341003-71341025 GTGGGGAGAGGGAGAGCATCAGG - Intronic
1098878967 12:75897017-75897039 GTTAATGGAGGGAGAGTATCAGG + Intergenic
1098979275 12:76937566-76937588 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1099148548 12:79078673-79078695 GTTGAGGGAGGGAGAGCATCAGG - Intronic
1099511914 12:83549240-83549262 GACGGTGGAGGGATAGCATCAGG - Intergenic
1099593249 12:84623203-84623225 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1099636176 12:85215482-85215504 GTGGGTAGAGGGAGAAGATCAGG - Intronic
1100045573 12:90376166-90376188 GTAGAAGGAGGGAGAGGATCAGG - Intergenic
1100665232 12:96744835-96744857 GTAGAGCAAGGGAGAGCATCAGG - Intronic
1100815520 12:98383550-98383572 GTGGGGAGAGGGAGAGGATCAGG + Intergenic
1100825425 12:98470402-98470424 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1100892503 12:99141561-99141583 GTTGGGGGAGGGAGAGCATCAGG - Intronic
1101186424 12:102285511-102285533 ATCGGGAGAGGGAGAGTATCAGG - Intergenic
1101368655 12:104102450-104102472 GTGGGAAGAGGGAGAGGATCAGG - Intronic
1101788715 12:107909658-107909680 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1101804081 12:108048224-108048246 GTCAATACAGGGAGGGCAGCTGG + Intergenic
1102322699 12:111951673-111951695 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1102423972 12:112826078-112826100 GTCGGTGTAGGGAGAGCTTCAGG - Intronic
1103074460 12:117970769-117970791 GTGTGTTGAGGGAGAGCATCAGG - Intergenic
1103197459 12:119057332-119057354 GCTGGGAGAGGGAGAGCATCAGG - Intronic
1103260167 12:119580504-119580526 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1103428264 12:120857822-120857844 GTGGGTGGAAGGAGAGCATCAGG + Intronic
1104193880 12:126511740-126511762 GTGGGAAGAGGGAGAGAATCAGG - Intergenic
1104334077 12:127876335-127876357 GAGGATGGAGGGAGAGGATCAGG - Intergenic
1104392439 12:128402376-128402398 GTGGAAGGAGGGAGAGGATCAGG - Intronic
1104457260 12:128925320-128925342 GTCGCAGGAGGCAGAGCATCAGG - Intronic
1104517870 12:129444596-129444618 GTGGGGAGGGGGAGAGCATCAGG - Intronic
1104532697 12:129587400-129587422 GTGGGAAGAGGGAGAGGATCAGG + Intronic
1105235564 13:18549221-18549243 GAGGGTAGAGGGAGAGGATCAGG - Intergenic
1105667937 13:22581051-22581073 GTAGGGAGAGGGAGAGCATCAGG - Intergenic
1105866536 13:24465625-24465647 GCAGGGAGAGGGAGAGCATCAGG + Intronic
1105930548 13:25047951-25047973 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1106372383 13:29148342-29148364 GTGGGAAGAGGGAGAGCATCAGG - Intronic
1106893447 13:34271590-34271612 GTTGGGAGAGAGAGAGCATCAGG - Intergenic
1106961513 13:35003919-35003941 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1107134571 13:36929987-36930009 GTGGGGAGAGGGAGAGGATCAGG - Intergenic
1107315123 13:39122771-39122793 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1107390840 13:39962439-39962461 ATGGGGAGAGGGAGAGCATCAGG - Intergenic
1107581694 13:41795800-41795822 GCGGGTAGGGGGAGAGCATCAGG + Intronic
1107698892 13:43027382-43027404 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1107993211 13:45836627-45836649 ATGGGGAGAGGGAGAGCATCAGG + Intronic
1108227059 13:48300873-48300895 GTGGGGAGAGGGAGAGCATCAGG - Intergenic
1108545810 13:51492211-51492233 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1108629411 13:52266995-52267017 GTTGGGAGAGGGAGAGCCTCAGG - Intergenic
1108656644 13:52539493-52539515 GTTGGGAGAGGGAGAGCCTCAGG + Intergenic
1109016737 13:57025389-57025411 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
1109146388 13:58785021-58785043 GTCAGGGGAGGGAGAGCATCAGG - Intergenic
1109414503 13:62020567-62020589 GTGAGGAGAGGGAGAGCATCAGG + Intergenic
1109555569 13:63970596-63970618 GTGGGTGGAGGGAGAGGATCAGG + Intergenic
1110129435 13:71988926-71988948 GTGGGGAGAGGGAGAGCATTAGG + Intergenic
1110260879 13:73483863-73483885 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1110297594 13:73886479-73886501 GTAGGGTGAGGGAGAGCATCAGG + Intronic
1110627570 13:77668607-77668629 GTGGATAGAGCGGGACCATCAGG - Intergenic
1110726004 13:78824670-78824692 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1111019126 13:82423583-82423605 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1111113268 13:83743165-83743187 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1111219782 13:85189190-85189212 GTAGGAAGAGGGAGAGAATCAGG + Intergenic
1111412947 13:87900036-87900058 GTAGAAGGAGGGAGAGGATCAGG + Intergenic
1111414855 13:87926833-87926855 GTGGGAAGAGGGAGAGCATCAGG + Intergenic
1111879566 13:93938889-93938911 GTCAAGAGATGGAGACCATCCGG + Intronic
1111939478 13:94594743-94594765 GTCATTTGGGGGAGAGCATCAGG - Intronic
1112487289 13:99831408-99831430 GCAGGTGGAGGGAGAGCATCAGG + Intronic
1112608967 13:100937317-100937339 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1112675217 13:101693523-101693545 GTGGGTTGAGGGAGAGGATCAGG + Intronic
1112846110 13:103646090-103646112 GTCAGGGGAGGGAGAGCATCAGG + Intergenic
1113519300 13:110927678-110927700 ATCGAGGGAGGGAGAGCATCAGG + Intergenic
1114448135 14:22805622-22805644 GTTGGTAGAGGGAGGGCATCAGG + Intronic
1114770255 14:25422664-25422686 GTGGAAGGAAGGAGAGCATCAGG - Intergenic
1114841962 14:26274093-26274115 GTAGGAAGAGGGAAAGCATCAGG + Intergenic
1114958686 14:27854858-27854880 GCAGAGAGAGGGAGAGCATCAGG + Intergenic
1115128739 14:30027244-30027266 GTGCAGGGAGGGAGAGCATCAGG - Intronic
1115188735 14:30723534-30723556 GTGGGAAGAGGGAGAGGATCAGG - Intronic
1115493742 14:33983303-33983325 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1115882476 14:37935281-37935303 GTTGGGGGAGGGAGAGCATCAGG - Intronic
1115938715 14:38584780-38584802 GTGGCAAGAGGGAGAGGATCAGG - Intergenic
1116343865 14:43762496-43762518 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1116546499 14:46172670-46172692 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1116575256 14:46566222-46566244 GGCAATAGAGGAAGAGCATGTGG + Intergenic
1116675260 14:47898502-47898524 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1116733143 14:48651365-48651387 GTCGGGGGAGGGAGAGGATCAGG + Intergenic
1116943722 14:50816215-50816237 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1117014145 14:51501350-51501372 GTTGGGGGAGGGAGAGCATCAGG - Intronic
1117108893 14:52428085-52428107 CTGGATAGAGGAATAGCATCTGG - Intergenic
1117261365 14:54037401-54037423 GTGGAGAGAGGGAGAGAAGCAGG - Intergenic
1118034425 14:61851042-61851064 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1118371578 14:65141692-65141714 GGCGGGTGAGGGAGAGCATCTGG - Intergenic
1118434715 14:65759743-65759765 GTGGGGAGAGGGAGAGTATCAGG - Intergenic
1118593106 14:67415983-67416005 GTGGCGGGAGGGAGAGCATCAGG + Intergenic
1118660254 14:68001679-68001701 ATGGGAAGAGGGAGAGCATCAGG - Intronic
1118735518 14:68698389-68698411 GTTGGGGGAGGGAGAGCATCAGG + Intronic
1120021536 14:79536596-79536618 GTAGAAGGAGAGAGAGCATCAGG - Intronic
1121103009 14:91263020-91263042 GGGGTTAGAGGGAGAGCATTTGG + Intergenic
1122594705 14:102881589-102881611 GTTAGGAGAGGGAGAGCATCAGG + Intronic
1125588164 15:40836794-40836816 TTGGAGGGAGGGAGAGCATCAGG + Intergenic
1126513798 15:49511594-49511616 GCAGAGGGAGGGAGAGCATCAGG - Intronic
1126673751 15:51139599-51139621 GTGGAAGGAGGGAGAGCATCAGG - Intergenic
1126959164 15:53970686-53970708 GCAGAGGGAGGGAGAGCATCAGG + Intergenic
1126981018 15:54243117-54243139 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1127003000 15:54532155-54532177 GTGGGAAGAGGGAGAGGATCAGG - Intronic
1127338845 15:58019963-58019985 GTGGGCGGAGGGAGAGCATCAGG - Intronic
1127636627 15:60876964-60876986 GTGGGAAGAGGGAGAGGATCAGG + Intronic
1127717077 15:61659100-61659122 GTGGCTAGAGGGAGGGCCTCTGG - Intergenic
1128918614 15:71590562-71590584 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1129278901 15:74468196-74468218 GTCAAGAGATGGAGACCATCTGG - Intergenic
1129334742 15:74845199-74845221 GTCGGTAGAGGGAGTGCACCTGG + Exonic
1130171552 15:81519935-81519957 GTTGCAGGAGGGAGAGCATCAGG + Intergenic
1130179495 15:81610660-81610682 GTGGGAAGAGGGAGAGAATCAGG + Intergenic
1131391701 15:92054587-92054609 GTGGGTGGAGGGAGAGCATCAGG - Intronic
1132421868 15:101676943-101676965 GAGGAGGGAGGGAGAGCATCAGG - Intronic
1133237235 16:4392952-4392974 GAAGAGAGAGGGAGAGGATCTGG - Intronic
1133474878 16:6111109-6111131 GGCGAGAGAGGGAGATCATGAGG + Intronic
1133515880 16:6508224-6508246 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1135474063 16:22757881-22757903 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1135501014 16:22995784-22995806 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1135621600 16:23960609-23960631 GAGGGAAGAGGGAGAGCATCAGG - Intronic
1135847244 16:25929934-25929956 ATGGAAGGAGGGAGAGCATCAGG - Intronic
1135853898 16:25988720-25988742 GTGGAGGGAGGGAGAGAATCAGG + Intronic
1135954002 16:26940497-26940519 GTCGGGGGAGGGAGAGCATTAGG - Intergenic
1136425496 16:30167425-30167447 GTCCATAGGGGCAGAGCATGGGG - Intergenic
1137465406 16:48703986-48704008 GTCGGGGGAGGGAGAGCATCAGG + Intergenic
1138319644 16:56101248-56101270 GTGGGGAGAGGGAGAGAATCAGG - Intergenic
1138830909 16:60373729-60373751 GCAGCGAGAGGGAGAGCATCAGG - Intergenic
1138832094 16:60386878-60386900 GTCGGGGGAGGGAGAGCATCAGG - Intergenic
1138862476 16:60774962-60774984 GTCGGGGGAGGGAGAGCATCAGG + Intergenic
1138968165 16:62111155-62111177 GTAGGGGGAGGGAGAGCATCTGG - Intergenic
1139256864 16:65550994-65551016 GTGGAGGGAGGGAGTGCATCAGG - Intergenic
1139617450 16:68106893-68106915 CACGAGAGAGGGAGAGCATCAGG - Intronic
1140030304 16:71331964-71331986 GTCGGGGGAGGGAGAGCATCAGG - Intergenic
1140256884 16:73345373-73345395 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1140301552 16:73762833-73762855 GCAGAGAGAGGGAGAACATCAGG + Intergenic
1140414102 16:74760963-74760985 GTGGGAGGAGGGAGAGCATCAGG + Intronic
1140611554 16:76605646-76605668 GTAGGAAGAGGGAGAGTATCAGG + Intronic
1140669566 16:77263914-77263936 GAGGAGGGAGGGAGAGCATCAGG - Intronic
1140808237 16:78553134-78553156 GTTGGGGGAGGGAGAGCATCAGG + Intronic
1142650957 17:1351521-1351543 GTTGATGGAGGGAAAGCATGCGG - Intronic
1142907705 17:3056527-3056549 GGCGGTGGAGGGAGAGAATCGGG - Intergenic
1142926860 17:3247732-3247754 GGCGGTGGAGGGAGAGAATCGGG + Intergenic
1143052920 17:4141547-4141569 GTGGAGGGAGAGAGAGCATCAGG + Intronic
1146488867 17:33265513-33265535 GTGGTGGGAGGGAGAGCATCAGG + Intronic
1146787098 17:35730253-35730275 GTCAAGAGATGGAGACCATCCGG + Intronic
1146917965 17:36690219-36690241 GACGATATATGGGGAGCATCCGG - Intergenic
1146995074 17:37313152-37313174 GTTGCAGGAGGGAGAGCATCAGG + Intronic
1148024383 17:44576117-44576139 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1148833538 17:50452526-50452548 GCCGGGGGAGGGAGAGCATCAGG + Intronic
1148974670 17:51516566-51516588 GTGGAGGGAGGGAGAGCATCAGG + Intergenic
1149355379 17:55834335-55834357 GCAGGGAGAGGGAGAGCATCAGG - Intronic
1149405759 17:56349238-56349260 CTGGGAAGAGGGAGAGCATCAGG + Intronic
1150321862 17:64221212-64221234 GCAGGAAGAGGGAGAGCATCAGG + Intronic
1150554632 17:66243102-66243124 GTCAAGAGATGGAGACCATCTGG - Intronic
1150831674 17:68526777-68526799 GTGGGAAGAGGGAGAGGATCAGG + Intronic
1150939091 17:69670760-69670782 GTAGGAGGAGGGAGAGCATCAGG - Intergenic
1152247643 17:79193511-79193533 GTGGATAGAGGCAGAGCAGGGGG - Intronic
1153120674 18:1722813-1722835 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1153358135 18:4161217-4161239 GTGGCGGGAGGGAGAGCATCAGG - Intronic
1153507109 18:5812205-5812227 GATGGGAGAGGGAGAGCATCAGG + Intergenic
1153529208 18:6027166-6027188 GTCAAGGGAGGGAGAGCATTAGG - Intronic
1154513975 18:15140778-15140800 GAGGGTAGAGGGAGAGGATCAGG + Intergenic
1155027509 18:21955754-21955776 GTGGGAAGAGGGAGAGCATCAGG + Intergenic
1155544134 18:26898059-26898081 GTGGGGAGAGGGCGAGCATCAGG - Intergenic
1155657247 18:28206598-28206620 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1155892103 18:31283230-31283252 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1157686238 18:49644886-49644908 GTCAAGAGATGGAGACCATCTGG + Intergenic
1157749384 18:50164728-50164750 GTGGCAAGAGGGAGAGCATCAGG - Intronic
1158765081 18:60441155-60441177 GTGGGTTGAGGGAGAGCACCAGG - Intergenic
1158813959 18:61071970-61071992 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1159473198 18:68882984-68883006 GTGGAAAGAGGGAGAGGATCAGG + Intronic
1159737890 18:72124882-72124904 GTTGGCAGAGGGATAGCATCAGG + Intergenic
1159760244 18:72416807-72416829 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1159762312 18:72443530-72443552 GCAAGTAGAGGGAGAGCATCAGG + Intergenic
1159854029 18:73563002-73563024 GTCGGAGGAGGGAGAGGATCAGG - Intergenic
1160087735 18:75794199-75794221 GTAGGGAGAGGGAGAGCATTAGG - Intergenic
1161255220 19:3305079-3305101 GTCGCTGGAGCGAAAGCATCCGG - Intergenic
1161634479 19:5378719-5378741 ATCGGGGGAGGGAGAGCATCAGG - Intergenic
1163067199 19:14806519-14806541 GTTGGCAGAGGGAGCGCATCAGG - Intronic
1164523305 19:28995306-28995328 GTGGGAAGAGGGAGAGGATCGGG - Intergenic
1164846203 19:31434675-31434697 GCTGGTGGAGGGAGAGCATCAGG + Intergenic
1164956397 19:32390504-32390526 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1165989365 19:39799254-39799276 GTGGGTGAAGGGAGAGCATCAGG + Intergenic
1166588740 19:43975543-43975565 GTGGAGGGAGGGAGAGCATCAGG + Intronic
925444318 2:3914875-3914897 GTCTATAGAGGGGGAGGAACTGG + Intergenic
925508893 2:4602687-4602709 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
925983304 2:9194342-9194364 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
926771645 2:16382629-16382651 GCGGAGGGAGGGAGAGCATCAGG - Intergenic
927014660 2:18946275-18946297 GTCGGGGGAGGGAGAGCATCGGG - Intergenic
927842439 2:26454234-26454256 CTGGATACAGGGAAAGCATCAGG + Intronic
928475442 2:31622102-31622124 GTGGAGGGAAGGAGAGCATCAGG - Intergenic
928946886 2:36779604-36779626 GTGGGAGGAGGGAGAGCATCAGG - Intronic
929256414 2:39815742-39815764 GTCGGGTGAGGGAGAGCATCAGG + Intergenic
929294154 2:40227568-40227590 GTGGGAAGAGGGAGAGCATCAGG + Intronic
929357596 2:41044662-41044684 GTGAATAGAGGGAGAGAATTGGG + Intergenic
929422382 2:41806202-41806224 GTGGGTGGAGGGAGAGCATCAGG + Intergenic
929728488 2:44459067-44459089 GTCTACAGAGGTAGAGCAGCTGG - Intronic
929935996 2:46295210-46295232 GTGGGAGGAGGGAGAGCATCAGG - Intronic
930149211 2:48041244-48041266 GTGAGTGGAGGGAGAGCATCGGG - Intergenic
930320479 2:49848397-49848419 GTAGGGGGAGGGAGAGCATCAGG - Intergenic
930544668 2:52751329-52751351 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
931076887 2:58725244-58725266 GTCGGTGGAGGGAGAGCATTGGG + Intergenic
932014312 2:68008921-68008943 GTGGAGAGAGGGAGAGCGTTAGG + Intergenic
932065819 2:68558774-68558796 GTAGGCAGAGGGAGAGCATCAGG - Intronic
932170514 2:69551247-69551269 GTGGAGGGAGAGAGAGCATCAGG + Intronic
933117262 2:78489825-78489847 GTGGGTGGAGGGAGAGGATCAGG + Intergenic
934058862 2:88275597-88275619 GTAGGGGGAGGGAGAGCATCAGG - Intergenic
934107241 2:88706560-88706582 GTGGGGGGAGGGAGAGCATCAGG + Intronic
934907791 2:98220979-98221001 GCAGAGGGAGGGAGAGCATCAGG + Intronic
934998128 2:98985391-98985413 GGGGGTGGAGGGAGAGCATCAGG - Intergenic
935007143 2:99089802-99089824 GTGGATAGAGGAAGACCCTCAGG - Intronic
935246246 2:101220948-101220970 GCAGGTGGAGGGAGAGCATCAGG + Intronic
935663764 2:105492238-105492260 GTCGGGGGAGGGAGAGCATTAGG - Intergenic
935774650 2:106462091-106462113 GTCGAGAGAGCGACACCATCTGG - Intronic
935905416 2:107833824-107833846 GTCGAGAGAGCGACACCATCTGG + Intronic
935952167 2:108339884-108339906 GGGCATGGAGGGAGAGCATCAGG - Intergenic
936237609 2:110757034-110757056 GTTGGAGGAGGGAGAGCATCAGG - Intronic
936275051 2:111088642-111088664 GTGGGAAGAGGGAGAGGATCAGG + Intronic
936605252 2:113945774-113945796 GTGGGAAGAGGGAGAGGATCAGG - Intronic
936824941 2:116570779-116570801 GGCAAAGGAGGGAGAGCATCAGG - Intergenic
937691143 2:124756777-124756799 GTGGGAGGAGGGAGAGCATCAGG + Intronic
938209331 2:129453665-129453687 GTTGGGAGAGGGAGAGCATTAGG + Intergenic
938514214 2:131985386-131985408 GAGGGTAGAGGGAGAGGATCAGG + Intergenic
939107098 2:137962017-137962039 GTGGGAAGAGGGAGAGAATCAGG + Intergenic
939521665 2:143239037-143239059 GTGGGGAGAGGGACAGCATCAGG + Intronic
939975593 2:148714037-148714059 GTGGGAGGAGGGAGAGCATCTGG - Intronic
940326318 2:152429037-152429059 GTGGGAGGAGGGAGAGCATCAGG + Intronic
940457874 2:153924192-153924214 GTGGGAAGAGGGAGTGCATCAGG - Intronic
941162298 2:162049492-162049514 GTGGGCAGAGAGAGAGCATCAGG + Intronic
941214602 2:162690238-162690260 GTGGAAAGAGGAAGAGAATCAGG + Intronic
941483509 2:166048334-166048356 GTGGGAAGAGGGAGAGGATCAGG - Intronic
942170991 2:173289498-173289520 GTCAATAGATCGAGACCATCTGG - Intergenic
942242945 2:173980357-173980379 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
942581521 2:177424094-177424116 GTAGAAGGAGGGAGAGCATCAGG - Intronic
942709623 2:178818416-178818438 GTTGGGGGAGGGAGAGCATCAGG - Intronic
942728775 2:179040514-179040536 GTGGGAGGAGGGAGAGCATCAGG - Intronic
942852101 2:180499804-180499826 GTGGAAAGAGGGAGAGGATCAGG - Intergenic
943066538 2:183092370-183092392 GTAGGAGGAGGGAGAGCATCAGG - Intronic
944126611 2:196301011-196301033 GTAGGGAGAGGGCGAGCATCAGG - Intronic
944163029 2:196686745-196686767 GTGGGTGGAGGGAGAGAATCAGG - Intronic
944172612 2:196796645-196796667 GTTGCGGGAGGGAGAGCATCAGG - Intronic
944277608 2:197856988-197857010 GTGGGAAGAGGGAGAGGATCAGG + Intronic
944356705 2:198798260-198798282 GTGCAGAGAGGGAGAGCATTAGG + Intergenic
944390094 2:199209085-199209107 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
944562732 2:200957016-200957038 GTGGAGGGAGGGAGAGCATAAGG + Intronic
945177413 2:207056587-207056609 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
945536632 2:211026044-211026066 GTGGATAGAGAAAGACCATCAGG + Intergenic
945785711 2:214234016-214234038 GTGGGAGGAGGGAGAGCATCAGG - Intronic
945841556 2:214893132-214893154 GTGGTTGGGGGGAGAGCATCAGG + Intergenic
945847694 2:214966246-214966268 ATGGAAGGAGGGAGAGCATCCGG + Intronic
945913702 2:215680327-215680349 GGCGGGGGAGGGAGAGCATCAGG + Intergenic
945917750 2:215721892-215721914 GTCGGGGGAGGGAGAGCATCAGG + Intergenic
946089759 2:217210516-217210538 GTTGGGAGAGGGAGAGCATCAGG - Intergenic
946246977 2:218393328-218393350 GGTGACAGAGGGAGACCATCTGG - Intronic
946779986 2:223184424-223184446 GTCAGGGGAGGGAGAGCATCAGG + Intronic
946785720 2:223241661-223241683 GTGGGAAGAGGGAGAGTATCAGG - Intergenic
946806459 2:223475699-223475721 GTAGCAAGAGGGAGAGCAACTGG + Intergenic
946838138 2:223793566-223793588 GTAGGAGGAGGGAGAGCATCAGG + Intronic
947097815 2:226586213-226586235 GTTGTGGGAGGGAGAGCATCAGG - Intergenic
947255709 2:228161551-228161573 GGTGAGGGAGGGAGAGCATCAGG + Intronic
947297723 2:228651118-228651140 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
947465709 2:230343219-230343241 GTAGGGAGAGGGACAGCATCAGG - Intronic
948669240 2:239556578-239556600 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1168744635 20:227832-227854 TTGGGTGGAGGGAGAGCATCAGG - Intronic
1169132243 20:3172427-3172449 GTAGATAGAGGAGGGGCATCAGG - Intronic
1169465838 20:5837442-5837464 GTGGGGGGAGGGAGAGCATCAGG - Intronic
1169499274 20:6143571-6143593 GTGGAAGGAGGGAGAGAATCAGG - Intergenic
1169611371 20:7383733-7383755 GTGGAAGGAGGGAGAGAATCAGG - Intergenic
1169773759 20:9229836-9229858 GTAGGGGGAGGGAGAGCATCAGG - Intronic
1169942179 20:10949121-10949143 GTCAAGAGAGCGAGACCATCTGG + Intergenic
1170162562 20:13328809-13328831 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1170242443 20:14183160-14183182 GTGGAAGGAGGGAGAGGATCAGG - Intronic
1172658674 20:36551791-36551813 GTCAAGAGATGGAGACCATCTGG - Intergenic
1173202590 20:40965179-40965201 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1173773933 20:45687143-45687165 GTCATAGGAGGGAGAGCATCAGG - Intronic
1173883778 20:46439126-46439148 GTGGGAAGAAGGAGAGCATCAGG + Intergenic
1174853650 20:54021733-54021755 GTTGGGGGAGGGAGAGCATCAGG + Intronic
1174924124 20:54738334-54738356 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1174948993 20:55022964-55022986 GTCGGAGGAGGGAGAGGATCAGG - Intergenic
1175046980 20:56116229-56116251 GGGGAGGGAGGGAGAGCATCAGG + Intergenic
1175596337 20:60237704-60237726 GGAGATAGGGGGAGGGCATCAGG - Intergenic
1176779566 21:13177506-13177528 GAGGGTAGAGGGAGAGGATCAGG - Intergenic
1176949070 21:15022394-15022416 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1177118435 21:17112785-17112807 GTTGGAGGAGGGAGAGCATCCGG + Intergenic
1177309015 21:19362871-19362893 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1177346957 21:19885681-19885703 GTGGAATGAGGGAGAGAATCAGG + Intergenic
1177351183 21:19944008-19944030 GTAGAAGGAGGGAGAGGATCAGG - Intergenic
1177416241 21:20796955-20796977 GTGGAAGGAGGGAGAGCATCAGG + Intergenic
1177977198 21:27866546-27866568 GAGGGTAGAGGGAGAGGATCAGG - Intergenic
1178172186 21:30053879-30053901 GTAGTTAGAGAGAGAGGATCTGG - Intergenic
1178395337 21:32237949-32237971 GCAGAAAGATGGAGAGCATCTGG - Intergenic
1179635948 21:42709307-42709329 GTTGGGGGAGGGAGAGCATCAGG + Intronic
1180021653 21:45132280-45132302 GTCGGCAGTGGGAGAGCAGCTGG + Intronic
1180891855 22:19294521-19294543 GTTGATAGAGGGAGACCACAGGG - Intergenic
1181905463 22:26191597-26191619 GTGGGAGGAGGGAGAGCATCAGG + Intronic
1182038425 22:27217404-27217426 GTCCCTAGAGGGAGAGCACAGGG - Intergenic
1184647613 22:45904655-45904677 GTCGGTGGAGGGAGAGGATCAGG - Intergenic
949576813 3:5346131-5346153 GGAGAGGGAGGGAGAGCATCAGG + Intergenic
949606798 3:5662255-5662277 GTGGAAGGAGGGAGAGCATTAGG - Intergenic
949607351 3:5668300-5668322 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
949637356 3:5997493-5997515 GTCGGGAGAGGGAGAGCATTAGG + Intergenic
949804813 3:7943133-7943155 GTTGGAAGAGGGAGAACATCAGG + Intergenic
949808547 3:7981271-7981293 GGCGGGAGAGGGAGAGCATCAGG - Intergenic
949896725 3:8772883-8772905 GCAGAGGGAGGGAGAGCATCAGG - Intronic
950143324 3:10630296-10630318 GTGGGAAGAGGGAGAGCATCAGG - Intronic
950882641 3:16335630-16335652 GTGGGAGGAGGGAGAGCATCAGG + Intronic
951903144 3:27677242-27677264 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
952050230 3:29376202-29376224 GTGGGAGGAGGGAGAGCATCAGG + Intronic
952103152 3:30038233-30038255 GTGGGGAAAGGGAGAGCATCAGG - Intergenic
952721468 3:36537560-36537582 GTAGTGAGAGGGAGAGCATCAGG + Intronic
952785146 3:37146444-37146466 GTGGGGTGAGGGAGAGCATCAGG - Intronic
953478766 3:43230428-43230450 GTGGGGAAAGGGAGAGCATCAGG + Intergenic
954501344 3:51019605-51019627 GTGGAAGGAGGAAGAGCATCAGG - Intronic
954770079 3:52959131-52959153 GACGGGGGAGGGAGAGCATCAGG + Intronic
955116959 3:56015346-56015368 GTCGGGGGAGGGAGAGCATTAGG - Intronic
955259005 3:57365464-57365486 GTAGGAGGAGGGAGAGCATCAGG + Intronic
955589049 3:60514498-60514520 GTGGGGAGAAGGAGAGCATCAGG + Intronic
955839235 3:63094540-63094562 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
955974783 3:64469368-64469390 GTCAATAGATCGAGACCATCTGG + Intergenic
956040717 3:65142313-65142335 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
956252228 3:67246540-67246562 GTGGGTGGAGGGAGAGGATCAGG - Intergenic
956860902 3:73322674-73322696 GCCGGAGGAGGGAGAGCATCAGG - Intergenic
957381265 3:79433157-79433179 GTGGGAAGAGGAAGAGCATCAGG - Intronic
958557212 3:95695285-95695307 GGGGAAAGAGGGAGAGAATCAGG + Intergenic
958576528 3:95956297-95956319 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
958782394 3:98558293-98558315 GTCGGGGGAGGGAGAGCATCAGG - Intronic
959006834 3:101029124-101029146 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
959287430 3:104433943-104433965 GCAGAGTGAGGGAGAGCATCAGG + Intergenic
959298757 3:104573273-104573295 GTGGAAGGAGGGAGAGCATCAGG - Intergenic
959326713 3:104946150-104946172 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
959339848 3:105114832-105114854 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
959371250 3:105528740-105528762 GTAGGAAGAGGGAGAGAATCAGG + Intronic
960201759 3:114845404-114845426 GTCTCTAGAGAGAGAGCATCAGG - Intronic
960384617 3:117007155-117007177 GTGGAGGGAGGGAGGGCATCAGG - Intronic
960451201 3:117810425-117810447 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
960681747 3:120255314-120255336 GGTGAGGGAGGGAGAGCATCAGG + Intronic
961589722 3:127968624-127968646 GTGGGAGGAGGGAGAGCATCAGG + Intronic
962151364 3:132896916-132896938 GGAGAAGGAGGGAGAGCATCAGG + Intergenic
962376335 3:134861725-134861747 ATCGGGGGAGGGAGAGCATCAGG + Intronic
962931137 3:140037683-140037705 GTCGGGGTAGGGAGAGCATCAGG - Intronic
963149634 3:142032054-142032076 GTGGAAAGAGGAAGAGCAGCAGG - Intronic
963344836 3:144082763-144082785 GTGAGGAGAGGGAGAGCATCAGG + Intergenic
963351391 3:144156125-144156147 GTAGGAAGAGGGAGAGGATCAGG + Intergenic
964302228 3:155301207-155301229 GTGGAAGGAGGGAGAGCATTAGG + Intergenic
964618326 3:158694441-158694463 GTGGGTGGAGGGAGAGGATCAGG + Intergenic
964826395 3:160832901-160832923 GTCGAGGGAGGGAGAGCATTAGG - Intronic
964878786 3:161400405-161400427 GTTGGGGGAGGGAGAGCATCAGG + Intergenic
964942564 3:162177138-162177160 GTTGGGGGAGGGAGAGCATCAGG + Intergenic
965653268 3:170955724-170955746 GTGGGGTGAGGGAGAGCATCAGG - Intergenic
965725081 3:171707166-171707188 GAAGGTAGAGGGAGAGGATCAGG + Intronic
965890049 3:173501239-173501261 GCCGGGGGAGGGAGAGCATCAGG - Intronic
965985502 3:174748166-174748188 GTGGAGGGAGGGAGAGCATTAGG + Intronic
966131004 3:176639781-176639803 GTGCAGGGAGGGAGAGCATCAGG - Intergenic
966145694 3:176809266-176809288 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
966273369 3:178135414-178135436 GTGGGAAGAGGGAGAGCATCAGG + Intergenic
966370913 3:179249887-179249909 GTAGGGGGAGGGAGAGCATCAGG + Intronic
966651838 3:182310200-182310222 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
966774133 3:183529158-183529180 GTGGGAAGAGGGAGAGGATCAGG + Intronic
966862911 3:184240688-184240710 GTCGATAGAGGGAGAAGCTGGGG + Intronic
966939631 3:184737410-184737432 CTTGAGAGAGGGAGAGCGTCAGG + Intergenic
967057113 3:185839098-185839120 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
967105244 3:186250333-186250355 GTTGGGGGAGGGAGAGCATCAGG + Intronic
967548232 3:190758155-190758177 GTGGATGGAGGGAGAGGATCAGG + Intergenic
967808944 3:193739013-193739035 GTCGGGGGAGGGAGAGCATTAGG + Intergenic
968436559 4:593583-593605 GTAGGGCGAGGGAGAGCATCAGG - Intergenic
969068307 4:4508691-4508713 CTAGGGAGAGGGAGAGCATCAGG - Intronic
969594286 4:8140107-8140129 GTGGGGGGAGGGAGAGCATCAGG + Intronic
969952109 4:10848280-10848302 GGGGAAGGAGGGAGAGCATCAGG - Intergenic
970008641 4:11434447-11434469 GTGGAGGGAGGGAGAACATCAGG - Intergenic
970061010 4:12034535-12034557 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
970209096 4:13688978-13689000 GTAGGAAGAGGGAGAGAATCAGG - Intergenic
970791124 4:19859345-19859367 GTGGGAGGAGGGAGAGCATCTGG - Intergenic
971185770 4:24374414-24374436 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
971323799 4:25627591-25627613 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
971347604 4:25825882-25825904 GTCAAGAGATGGAGACCATCTGG - Intronic
971429008 4:26543954-26543976 GTGGAGGGAGGGACAGCATCAGG - Intergenic
971447966 4:26772602-26772624 GATGAGGGAGGGAGAGCATCAGG - Intergenic
971464759 4:26945076-26945098 GTAAAAAGAGGGAGAGGATCAGG - Intronic
971507530 4:27382490-27382512 GCAGGCAGAGGGAGAGCATCAGG - Intergenic
971575393 4:28266472-28266494 GTCCATAGAGAGAGAACAACTGG + Intergenic
971645801 4:29200856-29200878 GTGGAGGGAGGGAGAGCATCAGG + Intergenic
972022121 4:34327854-34327876 GTGGGAAGAGGAAGAGCATCAGG + Intergenic
972153229 4:36122614-36122636 GTGGGAAGAGGGAGAGGATCAGG + Intronic
972470921 4:39403718-39403740 GTCGGAAGAAGGAGAGGATCAGG + Intergenic
973062448 4:45744566-45744588 GTGGAGAGAGGGAGAGCATTAGG - Intergenic
973544552 4:51967387-51967409 GTGGCAAGAAGGAGAGCATCAGG - Intergenic
973728037 4:53795482-53795504 GTGGGGGGAGGGAGAGCATCAGG + Intronic
973891567 4:55372608-55372630 GTGCGTAAAGGGAGAGCATCAGG + Exonic
974104940 4:57459076-57459098 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
974309998 4:60192922-60192944 GTAGAAAGAGGGAGAGGATCCGG + Intergenic
974687668 4:65251494-65251516 GTAGAAGGAGGGAGAGGATCAGG + Intergenic
974825131 4:67118677-67118699 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
974899004 4:67973586-67973608 GTGGGTGGAAGGAGAGCATCAGG - Intergenic
975194230 4:71504860-71504882 GTGGGAAGAGGGAGAGAATCAGG - Intronic
975239381 4:72039268-72039290 GTCGGGAGATGGAGACCATCTGG - Intronic
975630694 4:76399315-76399337 GCAGAAGGAGGGAGAGCATCAGG + Intronic
975680542 4:76871117-76871139 GTTGCAGGAGGGAGAGCATCAGG + Intergenic
975894697 4:79074754-79074776 TTGGAAGGAGGGAGAGCATCAGG + Intergenic
976260539 4:83140955-83140977 GTCAAGAGATGGAGACCATCTGG + Intergenic
976396199 4:84558346-84558368 GGCGGGGGAGGGAGAGCATCAGG - Intergenic
976525781 4:86086026-86086048 GTGGGTGGAGGGAGAGCATTAGG + Intronic
977027818 4:91842598-91842620 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
977049845 4:92116097-92116119 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
977083838 4:92569102-92569124 GTGGAAGGAGAGAGAGCATCAGG - Intronic
977141416 4:93376828-93376850 GTGCAGAGAGGGAGAGCATTAGG + Intronic
977484375 4:97623771-97623793 GTCGGGGGAGGAAGAGCATCAGG - Intronic
977502211 4:97854882-97854904 GTTGGGGGAGGGAGAGCATCAGG - Intronic
977520173 4:98072409-98072431 GTGCAGAGAGGGACAGCATCAGG + Intronic
977619763 4:99122958-99122980 GTAGGGGGAGGGAGAGCATCAGG + Intergenic
977619824 4:99123947-99123969 GTCGGCAGAGAGAGAGCATCAGG - Exonic
977669223 4:99676764-99676786 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
977980446 4:103314704-103314726 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
978068274 4:104433442-104433464 ATGGAAGGAGGGAGAGCATCAGG - Intergenic
978210411 4:106129278-106129300 GCGGAGAGAGGGAGAGCATCAGG - Intronic
978328395 4:107585197-107585219 GTCGGGGGAGGGAGAGCATCAGG + Intergenic
979609795 4:122677386-122677408 ATGGAGAGAGGGAGAGCATTAGG + Intergenic
979945428 4:126825492-126825514 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
980082421 4:128358105-128358127 GTCACCAGAGGCAGAGCATCTGG + Intergenic
980341635 4:131556373-131556395 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
981423354 4:144576795-144576817 GTGGAGAGAAGGAGAGAATCTGG - Intergenic
982195171 4:152904532-152904554 GCCGGAGGAGGGAGAGCATCAGG - Intronic
982295207 4:153821233-153821255 GTTGGGGGAGGGAGAGCATCAGG + Intergenic
982525630 4:156474241-156474263 GTAGAGGGAGGGAGAGCATCAGG + Intergenic
982747222 4:159116882-159116904 GTTGGGGGAGGGAGAGCATCAGG + Intronic
982962099 4:161852845-161852867 GTGGGAGGAGGGAGAGCATCAGG + Intronic
983166782 4:164487397-164487419 GCAGAGAGAGGAAGAGCATCAGG + Intergenic
983275063 4:165606947-165606969 GTGAAGGGAGGGAGAGCATCAGG - Intergenic
983283322 4:165708506-165708528 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
983315593 4:166129073-166129095 GTGGGGAGAGGGAGAGAATCAGG - Intergenic
983361177 4:166725351-166725373 GCAGTGAGAGGGAGAGCATCAGG - Intergenic
983597503 4:169487299-169487321 GTGGAGGAAGGGAGAGCATCAGG - Intronic
983659116 4:170114352-170114374 GTTGTGGGAGGGAGAGCATCAGG + Intergenic
983689767 4:170454045-170454067 GTGGAAGGAGGGAGAGAATCAGG - Intergenic
983831347 4:172331535-172331557 GTGGATAGAGGGACAGGAGCTGG - Intronic
984244437 4:177258020-177258042 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
984452914 4:179926631-179926653 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
984481315 4:180306617-180306639 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
984854512 4:184182863-184182885 GTAGAGGGAGGGAGAGCATCAGG + Intronic
985071932 4:186174214-186174236 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
985206548 4:187543817-187543839 GCAGGGAGAGGGAGAGCATCAGG + Intergenic
985272187 4:188204376-188204398 GTGGGTGGAGGGAGAGCATCAGG + Intergenic
985893707 5:2737032-2737054 GTGGATAGATGGACAGCATGCGG + Intergenic
985991021 5:3561421-3561443 GTGGGAAGAGGGAGGGCATCAGG - Intergenic
986381107 5:7186981-7187003 GTGAAGGGAGGGAGAGCATCAGG - Intergenic
986624296 5:9709035-9709057 TTCCATGGAGGGAGAGCATTAGG + Intronic
986793650 5:11188462-11188484 GTTGGGTGAGGGAGAGCATCAGG + Intronic
986994145 5:13586928-13586950 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
987431253 5:17836324-17836346 GTAGGGATAGGGAGAGCATCAGG - Intergenic
987502201 5:18727454-18727476 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
987553125 5:19409795-19409817 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
987576780 5:19738745-19738767 GTGGGAAGAGGGAGAGGATCAGG + Intronic
987987679 5:25170221-25170243 GTAGGAGGAGGGAGAGCATCTGG - Intergenic
988022708 5:25643703-25643725 GTGGAAAGAGGGAGAGGAACAGG + Intergenic
988154374 5:27431049-27431071 GTGGCAAGAGGGAGAGGATCAGG + Intergenic
988248302 5:28719057-28719079 GTGGAGGGAGGGACAGCATCAGG + Intergenic
988430717 5:31115439-31115461 GCAGGAAGAGGGAGAGCATCAGG + Intergenic
988537371 5:32080930-32080952 GTGGGGGGAGGGAGAGCATCAGG + Intronic
988647488 5:33110255-33110277 GTCGGGGGAGGGAGAGTATCAGG - Intergenic
988871076 5:35390587-35390609 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
989834733 5:45973053-45973075 GTCGGGGGAGGGATAGCATCAGG - Intergenic
990480123 5:56202155-56202177 GTGGGGAGAGGGGGAGCATCAGG + Intronic
990611325 5:57459625-57459647 GTAGGAGGAGGGAGAGCATCAGG + Intergenic
990945943 5:61249608-61249630 GCTGGGAGAGGGAGAGCATCAGG - Intergenic
991172072 5:63639721-63639743 GTGGAGGGAGGGAGAACATCAGG + Intergenic
991445556 5:66696210-66696232 GTGGGAGGAGGGAGAGCATCAGG + Intronic
992520160 5:77542284-77542306 GTGGGAGGAGGGAGAGCATCAGG + Intronic
992591861 5:78303936-78303958 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
992601953 5:78410266-78410288 GTGGGCAAAGGGAGAGCATCAGG - Intronic
992672217 5:79071669-79071691 GTGGAAGGAGGGAGAGGATCAGG + Intronic
992864693 5:80946018-80946040 GCAGAGGGAGGGAGAGCATCAGG - Intergenic
993040774 5:82812262-82812284 GGCGGGGGAGGGAGAGCATCAGG - Intergenic
993082991 5:83325444-83325466 GTTGGGGGAGGGAGAGCATCAGG - Intronic
993270527 5:85790656-85790678 GCAGAAGGAGGGAGAGCATCAGG - Intergenic
993301230 5:86213557-86213579 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
993335953 5:86659180-86659202 GTAGAGGGAGGAAGAGCATCAGG - Intergenic
993686730 5:90946595-90946617 GTGGGGGGAGGGAGAGCATCAGG - Intronic
994028917 5:95118029-95118051 GTGGAGGGAGGGAGAGCATTAGG + Intronic
994225629 5:97249178-97249200 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
994387976 5:99154683-99154705 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
995144660 5:108773325-108773347 GTGGGGAAAGGGAGAGCATCAGG - Intronic
995357670 5:111258014-111258036 GTCGGGGGAGGGAGAGTATCAGG + Intronic
995847911 5:116513760-116513782 ATGGAAGGAGGGAGAGCATCGGG - Intronic
995928678 5:117408245-117408267 GTGGAAGGAGGGAGAGCATCAGG - Intergenic
995965231 5:117898620-117898642 CTTGAAGGAGGGAGAGCATCAGG - Intergenic
996109780 5:119551825-119551847 GCAGGTAGAGGGAGAGCATCAGG - Intronic
996166613 5:120231553-120231575 GTAGAAGGAGGGAGAGAATCAGG - Intergenic
996197821 5:120631734-120631756 GTGGGTAGAGGCAGACCATCAGG - Intronic
996496845 5:124168140-124168162 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
996505189 5:124260790-124260812 GGTGGCAGAGGGAGAGCATCAGG - Intergenic
996806688 5:127463321-127463343 GTGGGAGGAGGGAGAGCATCAGG - Intronic
997044793 5:130301412-130301434 GTCTCAAGAGGAAGAGCATCTGG - Intergenic
997517337 5:134499895-134499917 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
997906561 5:137822979-137823001 GTAGAGGGAGGGAGAGCAGCTGG - Intergenic
997909285 5:137853547-137853569 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
998907694 5:146924082-146924104 GTGGAAGGAGGGAGAGGATCAGG + Intronic
999040365 5:148402987-148403009 GGTGGTACAGGGAGAGCATCAGG + Intronic
999297509 5:150468932-150468954 GTCGGGGGAGGGAGAGCATCAGG - Intergenic
999480115 5:151940548-151940570 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
999510864 5:152250463-152250485 GTGGTGGGAGGGAGAGCATCAGG - Intergenic
999811813 5:155134673-155134695 GTTGAAGGAGGGAGAGCATCAGG - Intergenic
999836065 5:155374343-155374365 ATGGAAGGAGGGAGAGCATCAGG - Intergenic
1000264504 5:159621598-159621620 GTGGATAGAGAAAGACCATCAGG - Intergenic
1000368782 5:160515398-160515420 GTGGGAGGAGGGAGAGCATCGGG + Intergenic
1000638072 5:163666379-163666401 GTGGGGAGAGGGAGAGCATCAGG - Intergenic
1000721869 5:164718377-164718399 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1000845787 5:166279049-166279071 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1001208609 5:169788972-169788994 GTAGAAGGAGGGAGAGGATCAGG - Intronic
1001748894 5:174112814-174112836 GTTGGGGGAGGGAGAGCATCGGG - Intronic
1002379899 5:178819212-178819234 GTGGGAGGAGGGAGAGCATCTGG + Intergenic
1002609740 5:180408383-180408405 GTCAAGAGATGGAGACCATCTGG - Intergenic
1002966433 6:1970809-1970831 GTGGAAGGAGGGAGAGCATCAGG + Intronic
1003229781 6:4241649-4241671 GTCGGGGGAGGGAGAGCATCAGG - Intergenic
1003323289 6:5071959-5071981 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1003606472 6:7565838-7565860 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1003888352 6:10541152-10541174 GTTGGCAGAGGGAAAGCATCAGG - Intronic
1004899234 6:20179077-20179099 GTGGGGAGAGGGAGAGCATCAGG - Intronic
1004975785 6:20964662-20964684 GTGGGAGGAGGGAGAGCATCAGG + Intronic
1005151798 6:22760158-22760180 ATGGAGGGAGGGAGAGCATCAGG - Intergenic
1005238583 6:23795661-23795683 GTCGGGGGAGGGAGAACATCAGG + Intergenic
1005436092 6:25813706-25813728 GTGGGAAGAGGGAGAGGATCAGG - Intronic
1005794898 6:29349373-29349395 GTGGAGGGTGGGAGAGCATCAGG - Intergenic
1006250785 6:32781904-32781926 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1006261311 6:32873925-32873947 TTGGAGGGAGGGAGAGCATCAGG - Intergenic
1006305981 6:33219040-33219062 GTGGCAGGAGGGAGAGCATCAGG - Intergenic
1007049847 6:38816214-38816236 GTGAAGGGAGGGAGAGCATCAGG - Intronic
1007872872 6:45061449-45061471 GCAGGGAGAGGGAGAGCATCAGG + Intronic
1008029952 6:46684477-46684499 GCCTATAAAGGGATAGCATCAGG - Intergenic
1008191117 6:48459382-48459404 GTGGAAGGAGGGAGAGGATCAGG - Intergenic
1008318753 6:50080600-50080622 GTGGAAGGAGGGAGAGCATCAGG - Intergenic
1008322259 6:50130848-50130870 GTCGAAAGAGTAAGACCATCTGG - Intergenic
1008707290 6:54178056-54178078 GTAGGGAGAGGGAGAGCGTCAGG + Intronic
1008711208 6:54229503-54229525 GTGGGAAGAGGGAGAGCATCAGG - Intronic
1008801495 6:55373883-55373905 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1009279451 6:61728297-61728319 GTGGAGGGAGGGAGGGCATCAGG + Intronic
1009400237 6:63246082-63246104 GTAGGCAGAGGGAGAGCATCAGG - Intergenic
1009485235 6:64213098-64213120 GTGGGAAGAGGGAGAGGATCAGG + Intronic
1009517431 6:64637755-64637777 GCTGGGAGAGGGAGAGCATCAGG + Intronic
1009690723 6:67029331-67029353 GTTGCAAGAGGGAGAGAATCAGG - Intergenic
1009939552 6:70274342-70274364 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1010165349 6:72908201-72908223 GTGGAGAGAGGGAGAACATGGGG + Intronic
1010320824 6:74507374-74507396 GTAGGGAGAGGAAGAGCATCAGG + Intergenic
1010946975 6:81986578-81986600 GTTGCGGGAGGGAGAGCATCAGG - Intergenic
1011063457 6:83297727-83297749 GTCGGGGCAGGGAGAGCATCAGG - Intronic
1011174985 6:84550359-84550381 GTAGGGGGAGGGAGAGCATCAGG - Intergenic
1011513625 6:88128144-88128166 GTCAAGAGATGGAGACCATCCGG - Intergenic
1011732712 6:90282293-90282315 GTGGGAAGAGGGAGAGAATCAGG - Intronic
1011975230 6:93287666-93287688 GTGGAAGGAGGGAGAGGATCAGG - Intronic
1011992212 6:93536072-93536094 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1011992651 6:93542287-93542309 GTGCAGGGAGGGAGAGCATCAGG + Intergenic
1012152789 6:95776326-95776348 GTGGAAAGAGGGAGAGGATCAGG - Intergenic
1012166170 6:95955226-95955248 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1012942035 6:105425678-105425700 ATGGATGGAGGGAGAGCATCAGG + Intergenic
1013484257 6:110580799-110580821 GTCGGGGGAAGGAGAGCATCAGG + Intergenic
1013620831 6:111887188-111887210 GTCAGTAGAAGGAGAGGATCAGG + Intergenic
1013722150 6:113043225-113043247 GTAAATAGAGGGAGACCATTAGG + Intergenic
1013780220 6:113720547-113720569 GTCAGGGGAGGGAGAGCATCAGG - Intergenic
1013872650 6:114785450-114785472 GTTGATAGAGGCAGAGAGTCAGG - Intergenic
1014510850 6:122320386-122320408 GTGGGAAGAGGGAGAGGATCGGG - Intergenic
1014622690 6:123688593-123688615 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1014731656 6:125038969-125038991 GTGGAGGGAGGGAGAGCATTAGG - Intronic
1015033181 6:128621456-128621478 GTAGGGAGAGGGAGAGCATCCGG - Intergenic
1015192866 6:130490648-130490670 GTGGAAGGAAGGAGAGCATCAGG - Intergenic
1015410723 6:132891141-132891163 TGGGTTAGAGGGAGAGCATCAGG + Intergenic
1015470887 6:133604936-133604958 GTGGAAGGAGGGAGAGAATCAGG - Intergenic
1015491599 6:133832863-133832885 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1015584696 6:134763585-134763607 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1016251213 6:142045235-142045257 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
1016339288 6:143044365-143044387 GCAGGGAGAGGGAGAGCATCAGG - Intergenic
1016624757 6:146153644-146153666 GTGCAGGGAGGGAGAGCATCTGG + Intronic
1016634027 6:146267026-146267048 GTAGGGGGAGGGAGAGCATCAGG - Intronic
1016695186 6:146985984-146986006 GTAGGAAGAGGTAGAGCATCAGG - Intergenic
1016874700 6:148853097-148853119 GGGGAGGGAGGGAGAGCATCAGG - Intronic
1017204333 6:151788963-151788985 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1017644420 6:156526184-156526206 GCAGGGAGAGGGAGAGCATCAGG - Intergenic
1017745142 6:157440016-157440038 GTGGGAGGAGGGAGAGCATCAGG + Intronic
1018348407 6:162927644-162927666 GTCAGAGGAGGGAGAGCATCAGG + Intronic
1019046432 6:169151726-169151748 ATGGAAGGAGGGAGAGCATCAGG + Intergenic
1019826351 7:3287585-3287607 GTCTGGGGAGGGAGAGCATCAGG - Intergenic
1020259349 7:6521898-6521920 GTCCATTGAGGAAGAGGATCCGG + Exonic
1020654768 7:10916287-10916309 GTAGGAAGAGGGAGAGGATCAGG + Intergenic
1020708929 7:11580743-11580765 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1021245068 7:18251367-18251389 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1021776963 7:24063717-24063739 GTTGGGGGAGGGAGAGCATCAGG + Intergenic
1022043807 7:26606773-26606795 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1022181886 7:27928798-27928820 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1022313571 7:29221602-29221624 GTCGAGGAAGGGAGAGCATCAGG - Intronic
1022638106 7:32156268-32156290 GTAGAGAGAGGGAGAGCATGAGG - Intronic
1022656084 7:32320365-32320387 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1022764668 7:33397827-33397849 GTCAGGGGAGGGAGAGCATCAGG + Intronic
1023053669 7:36274689-36274711 GTCAATGGAGGGACAGCATTAGG - Intronic
1024593244 7:50908386-50908408 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1024690456 7:51796047-51796069 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1025001869 7:55322542-55322564 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1025784279 7:64630306-64630328 GTGGGTAGAGGGAGAAAATCAGG + Intergenic
1026053312 7:66964836-66964858 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1026106917 7:67428683-67428705 GTCAGGGGAGGGAGAGCATCAGG + Intergenic
1026255834 7:68710289-68710311 GTTGGGGGAGGGAGAGCATCAGG + Intergenic
1026304295 7:69126606-69126628 GTGGGGAGAGGGAGAGCTTCAGG + Intergenic
1026491861 7:70870457-70870479 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1026645248 7:72161779-72161801 GTGGGAAGAGGGAGAGCATCCGG + Intronic
1026778478 7:73247266-73247288 GTAGGGGGAGGGAGAGCATCAGG + Intergenic
1026823580 7:73566625-73566647 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1027267626 7:76502968-76502990 GCCGATGCAGGGAGAGCAGCTGG - Intronic
1027319439 7:77002833-77002855 GCCGATGCAGGGAGAGCAGCTGG - Intergenic
1028390909 7:90315612-90315634 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1028776760 7:94685822-94685844 GCGGATGGAGGGAGAGTATCTGG + Intergenic
1029645048 7:101849310-101849332 GTGGAAAGAGGGAGAGGATCAGG - Intronic
1030329868 7:108259847-108259869 GTGGAGGGAGAGAGAGCATCAGG + Intronic
1030404222 7:109089797-109089819 GTGGGAAGAGGGAGAGCCTCAGG + Intergenic
1030712313 7:112764708-112764730 GTCAAGAGATGGAGACCATCTGG - Exonic
1031255133 7:119436858-119436880 GTTGGAGGAGGGAGAGCATCAGG + Intergenic
1031291896 7:119949001-119949023 GTGGAAAGAAGGAGAGGATCAGG - Intergenic
1031537611 7:122954523-122954545 ATCGAGGGAGGGAGAGCATCAGG - Intergenic
1032431462 7:131865283-131865305 GTCTAGAGATGGAGAACATCTGG - Intergenic
1032637995 7:133732290-133732312 ATGGAGGGAGGGAGAGCATCAGG + Intronic
1032897316 7:136265583-136265605 GTGGAGGGAGGGAGAGCTTCAGG - Intergenic
1032900515 7:136301801-136301823 GTGGGGTGAGGGAGAGCATCAGG + Intergenic
1033681643 7:143601111-143601133 GTGGATGGAGGGAGACCATCAGG + Intergenic
1033703249 7:143860702-143860724 GTGGATGGAGGGAGACCATCAGG - Intronic
1034271266 7:149804402-149804424 GTGGAAAGAGGGAAACCATCTGG - Intergenic
1035135776 7:156701772-156701794 GTCGGGGGAGGGAGAGAATCAGG - Intronic
1035480737 7:159180852-159180874 GTGAAAAGAGGGAGAGAATCAGG + Intergenic
1035748385 8:1978137-1978159 GGCGGCGGAGGGAGAGCATCAGG - Intronic
1035821825 8:2601113-2601135 GTCGGGGAAGGGAGAGCATCAGG - Intergenic
1035856015 8:2977246-2977268 GTAGGGGGAGGGAGAGCATCAGG - Intronic
1036713113 8:11094890-11094912 GCTGAAGGAGGGAGAGCATCAGG + Intronic
1036742442 8:11376336-11376358 GTAGAAGGAGGGAGAGGATCAGG + Intergenic
1037470781 8:19207989-19208011 GTAGGGGGAGGGAGAGCATCAGG + Intergenic
1038402531 8:27296304-27296326 CTGGGGAGAGGGAGAGCATCAGG - Intronic
1038594584 8:28875633-28875655 GTAGGGGGAGGGAGAGCATCAGG - Intronic
1038699179 8:29834220-29834242 GTGGGAAGAGGGAGAGCATCAGG - Intergenic
1038855212 8:31323784-31323806 GCAGGGAGAGGGAGAGCATCAGG - Intergenic
1039022394 8:33222316-33222338 GTGAGTGGAGGGAGAGCATCAGG + Intergenic
1039413110 8:37372211-37372233 GCATATAGAGGGAGGGCATCTGG + Intergenic
1039460834 8:37742665-37742687 GTGGGGAGAGGGAGAGCATCAGG + Intronic
1040360825 8:46662668-46662690 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1040891266 8:52318936-52318958 GTGGGAAGAGGGAGAGGATCGGG + Intronic
1040964192 8:53067575-53067597 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1041345814 8:56896777-56896799 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1041364643 8:57089122-57089144 GTGGGGGGAGGGAGAGCATCTGG - Intergenic
1041487551 8:58395727-58395749 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1041625464 8:60020910-60020932 GTGGAGGGAAGGAGAGCATCAGG - Intergenic
1041972081 8:63755219-63755241 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1042354529 8:67811994-67812016 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1042690510 8:71492894-71492916 GTGGAAGGAGGGAGAGGATCAGG - Intronic
1042774164 8:72411170-72411192 GCAGGTGGAGGGAGAGCATCAGG + Intergenic
1042807012 8:72781964-72781986 CTGGGGAGAGGGAGAGCATCAGG + Intronic
1042818485 8:72904370-72904392 GTAGAAGGAGGGAGAGGATCAGG + Intronic
1042820621 8:72926104-72926126 GTTGGGGGAGGGAGAGCATCAGG + Intronic
1042843109 8:73144480-73144502 GGTGGGAGAGGGAGAGCATCAGG + Intergenic
1042922500 8:73933637-73933659 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1043668851 8:82855137-82855159 ATTGACACAGGGAGAGCATCAGG + Intergenic
1043732538 8:83701646-83701668 GTTGCAAAAGGGAGAGCATCAGG + Intergenic
1043979997 8:86626984-86627006 GTGGGTAGAGGGACAGGATCAGG - Intronic
1044127840 8:88480207-88480229 GTAGGGGGAGGGAGAGCATCAGG + Intergenic
1044166900 8:88995898-88995920 GTCAAGAGATTGAGAGCATCTGG - Intergenic
1044447028 8:92290882-92290904 GCAGGAAGAGGGAGAGCATCAGG - Intergenic
1044940772 8:97340911-97340933 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
1045091804 8:98753481-98753503 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1045394020 8:101742807-101742829 TTGGATGGAGGGAGAGCATCAGG - Intronic
1045703875 8:104897669-104897691 GTGGAGGGAGGGAGAGCATTAGG + Intronic
1045885866 8:107097368-107097390 GTGTAAAGAGGGAGAGGATCAGG + Intergenic
1045957322 8:107923950-107923972 GTAGAAAGAGGGAGAGAGTCAGG + Intronic
1046145256 8:110150009-110150031 GTGGAGGGAGGGAGAGCATCAGG - Intergenic
1046398966 8:113678247-113678269 ATGGAAGGAGGGAGAGCATCAGG + Intergenic
1046895651 8:119469359-119469381 GTCAAAAGAAGGAGAGCATCCGG + Intergenic
1047085952 8:121515362-121515384 GTGGGGAGAGGGAGAGCATTAGG - Intergenic
1047875239 8:129129515-129129537 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1048132777 8:131716154-131716176 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1048381701 8:133871190-133871212 GTGGCGGGAGGGAGAGCATCAGG - Intergenic
1049072350 8:140365902-140365924 GTAGAAGGAGGGAGAGGATCAGG - Intronic
1049703883 8:144029057-144029079 GTTGGGGGAGGGAGAGCATCAGG + Intronic
1050245478 9:3685355-3685377 GATGGCAGAGGGAGAGCATCAGG - Intergenic
1050315012 9:4392250-4392272 GTCGGGGGAGGGAGAACATCAGG + Intergenic
1050470662 9:5986109-5986131 GTAGAGGGAGGGAGAGCATCAGG - Intronic
1050758844 9:9041345-9041367 GTGGAAAGAGGCAGAGGATCAGG - Intronic
1051811880 9:21058315-21058337 GGAGAAGGAGGGAGAGCATCAGG + Intergenic
1051914400 9:22190965-22190987 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1052165365 9:25319775-25319797 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1052176221 9:25466171-25466193 GTGAGAAGAGGGAGAGCATCAGG - Intergenic
1052422031 9:28254898-28254920 GTGGAAACAGGGAGAGGATCAGG - Intronic
1052450281 9:28620837-28620859 GTGGGAAGAGGGAGAGGATCAGG + Intronic
1053639848 9:40061725-40061747 GTCGGGGGAGGGAGACCATCTGG - Intergenic
1053766284 9:41403760-41403782 GTCGGGGGAGGGAGACCATCTGG + Intergenic
1054320600 9:63658037-63658059 GTCGGGGGAGGGAGACCATCTGG - Intergenic
1054544900 9:66314916-66314938 GTCGGGGGAGGGAGACCATCTGG + Intergenic
1055076623 9:72221689-72221711 ATGGAAGGAGGGAGAGCATCAGG - Intronic
1055090178 9:72356432-72356454 GTCGATAGAGGGAGAGCATCTGG - Intronic
1055094739 9:72400378-72400400 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1055343502 9:75310045-75310067 GTGGAGGGAGGTAGAGCATCAGG - Intergenic
1055746743 9:79455490-79455512 GTGGGTGGAGGGAGAGGATCAGG - Intergenic
1056098723 9:83279805-83279827 GTCGGGGGAGGGAGAGCGTCAGG + Intronic
1056488102 9:87079103-87079125 GTGGAAGGAGAGAGAGCATCAGG + Intergenic
1056524569 9:87431316-87431338 GTGAGGAGAGGGAGAGCATCAGG - Intergenic
1056837526 9:89968977-89968999 GCAGGTGGAGGGAGAGCATCAGG + Intergenic
1057284177 9:93735702-93735724 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1057324077 9:94044438-94044460 GTCGGGGGAGGAAGAGCATCAGG - Intronic
1057412576 9:94830176-94830198 GCAGGGAGAGGGAGAGCATCAGG - Intronic
1057731393 9:97611994-97612016 GTGGAAGGAGGGAGAGGATCAGG - Intronic
1058098369 9:100889279-100889301 ATGGAGGGAGGGAGAGCATCAGG - Intergenic
1058290695 9:103237369-103237391 GGCGAGAGAGGGAGAGGATCTGG + Intergenic
1058549655 9:106100617-106100639 GCAGGGAGAGGGAGAGCATCAGG - Intergenic
1059043605 9:110841228-110841250 GTCGGGGGAGGGATAGCATCAGG - Intergenic
1059064841 9:111072420-111072442 GTGGAGGTAGGGAGAGCATCAGG - Intergenic
1059111559 9:111562732-111562754 GGTGAGGGAGGGAGAGCATCAGG - Intronic
1059225963 9:112673238-112673260 GTAGAGGGAGAGAGAGCATCAGG - Intergenic
1059961582 9:119570127-119570149 GGCGGGGGAGGGAGAGCATCAGG + Intergenic
1060296145 9:122344213-122344235 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1060764768 9:126286042-126286064 ATGGAAAGAGGGAGAGGATCAGG + Intergenic
1202787672 9_KI270719v1_random:45106-45128 GTCGGGGGAGGGAGACCATCTGG - Intergenic
1185963900 X:4577937-4577959 GGCAAGGGAGGGAGAGCATCAGG - Intergenic
1186147520 X:6640059-6640081 GTAGGAAGAGGGAGAGGATCAGG - Intergenic
1186172697 X:6894106-6894128 GATGGGAGAGGGAGAGCATCAGG + Intergenic
1186318109 X:8392941-8392963 GAAGGTGGAGGGAGAGCATCAGG + Intergenic
1186624189 X:11274763-11274785 GTTGGGGGAGGGAGAGCATCAGG - Intronic
1186646998 X:11517828-11517850 GTTGGGGGAGGGAGAGCATCAGG + Intronic
1187078601 X:15962213-15962235 GTCAATGCAGTGAGAGCATCAGG + Intergenic
1187082551 X:16006688-16006710 GTGGGGAGAGGGAGAGCATTAGG - Intergenic
1187818706 X:23261893-23261915 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1187999777 X:24969791-24969813 GTGGGAGGAGGGAGAGCATCAGG - Intronic
1188163921 X:26838018-26838040 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1188738264 X:33744572-33744594 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1188902174 X:35747015-35747037 GTGGAAGGAGGGAGAGCATCAGG + Intergenic
1189739363 X:44102418-44102440 GTCAAGAGATGGAGACCATCTGG + Intergenic
1189798739 X:44672610-44672632 GCAGGCAGAGGGAGAGCATCAGG + Intergenic
1189806204 X:44737740-44737762 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1189931675 X:46018702-46018724 GTCGGGGGAGGGACAGCATCAGG - Intergenic
1190126578 X:47710699-47710721 GCGGGGAGAGGGAGAGCATCAGG + Intergenic
1190441426 X:50478477-50478499 GTGGCGGGAGGGAGAGCATCAGG + Intergenic
1190859586 X:54331068-54331090 GTGGGAGGAGGGAGAGCATCAGG + Intronic
1190902747 X:54694502-54694524 GTGGGAAGAGGGAGAGGATCTGG + Intergenic
1191032018 X:55984263-55984285 GCGGGTAGAGGGAGAGCATCAGG - Intergenic
1191834466 X:65449163-65449185 GTGAGGAGAGGGAGAGCATCAGG + Intronic
1191888259 X:65912483-65912505 GTGGGAAGAGGGAGAGGATCAGG - Intergenic
1191929817 X:66358859-66358881 GTAGGAAGAGGGAGAGAATCAGG + Intergenic
1192961291 X:76133778-76133800 GTGAAGGGAGGGAGAGCATCAGG + Intergenic
1192995660 X:76510035-76510057 GTAGGAGGAGGGAGAGCATCAGG + Intergenic
1193063810 X:77235515-77235537 GTAGGGGGAGGGAGAGCATCAGG + Intergenic
1193458498 X:81760510-81760532 GTGGGCAGAGGGAGAGCATAAGG + Intergenic
1193581335 X:83266756-83266778 GTAGGTGGAGGGAGAGAATCAGG + Intergenic
1193586043 X:83322718-83322740 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1193687643 X:84597537-84597559 GTGGAGAGAGTGAGAGTATCAGG + Intergenic
1193774714 X:85627924-85627946 GTCAGGAGAGGGAGAGCATCGGG + Intergenic
1193826518 X:86233199-86233221 GTGGAAGGAGGGAGAGGATCAGG + Intronic
1194253790 X:91612096-91612118 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1194279515 X:91931963-91931985 GTGGGGTGAGGGAGAGCATCAGG - Intronic
1194329812 X:92567854-92567876 GTGGTGGGAGGGAGAGCATCAGG + Intronic
1194369064 X:93047956-93047978 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1194459388 X:94147803-94147825 GCAGTGAGAGGGAGAGCATCAGG - Intergenic
1194541231 X:95175275-95175297 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1194565133 X:95477249-95477271 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1194720396 X:97333921-97333943 TTGGACATAGGGAGAGCATCTGG - Intronic
1194790773 X:98146764-98146786 GTAGGGGGAGGGAGAGCATCAGG - Intergenic
1194868742 X:99101150-99101172 GCAGAAGGAGGGAGAGCATCAGG + Intergenic
1195216070 X:102704224-102704246 GTGGAGGGAGGGAGAGCATCAGG + Intergenic
1195247757 X:103011099-103011121 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1195333863 X:103830984-103831006 ATCGATAGGGGAAGAGCAACTGG + Intronic
1195532466 X:105972041-105972063 GTAGGGAGAAGGAGAGCATCAGG + Intergenic
1195540860 X:106061146-106061168 GTTGAAAGAGGGAGAGGATTGGG - Intergenic
1195664247 X:107414185-107414207 GTCAATAGATCGAGACCATCTGG - Intergenic
1195728621 X:107942407-107942429 GTAGGAAGAGGGAGAGGATCAGG + Intergenic
1195784971 X:108509289-108509311 GTGGGAAGAGGGAGAGGATCAGG + Intronic
1196214132 X:113030396-113030418 GCAGATGGAGGGAGAGCATCAGG + Intergenic
1196600684 X:117598463-117598485 GATGAGAGAGGGAGAGCGTCAGG + Intergenic
1196711038 X:118763033-118763055 GTGGGAGGAGGGAGAGCATCAGG + Intronic
1196741095 X:119026715-119026737 GTGGTGGGAGGGAGAGCATCAGG + Intergenic
1196779582 X:119371521-119371543 GTGGGAGGAGGGAGAGCATCAGG - Intergenic
1197015399 X:121620131-121620153 GTGGGGAGAGAGAGAGCATCAGG - Intergenic
1197357254 X:125450573-125450595 GCAGAGGGAGGGAGAGCATCAGG + Intergenic
1197505657 X:127300425-127300447 GTGGGAAGAGGGAGAGTATCAGG + Intergenic
1197534876 X:127675175-127675197 GCTGGGAGAGGGAGAGCATCAGG - Intergenic
1197564436 X:128064408-128064430 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
1197677407 X:129345630-129345652 GTAGAGGGAGGGAGAGCATCAGG - Intergenic
1197680854 X:129382855-129382877 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1197907827 X:131445107-131445129 GTAGATGGAGGGAGAGGATCAGG + Intergenic
1197946663 X:131846429-131846451 GTGGGGAGAGGGAGAGCATTAGG + Intergenic
1197971182 X:132116673-132116695 GCCGGCGGAGGGAGAGCATCAGG + Intronic
1197990899 X:132315996-132316018 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1198079595 X:133226815-133226837 GTTGGGGGAGGGAGAGCATCAGG - Intergenic
1198501192 X:137248837-137248859 GTTGGAAGAGGGAGAGAATCAGG + Intergenic
1198649883 X:138850869-138850891 ATCGGGGGAGGGAGAGCATCAGG - Intronic
1199095945 X:143738674-143738696 GTGGCAAGAGGGAGAGCATCAGG + Intergenic
1199223585 X:145344901-145344923 GTAGAAGGAGGGAGAGGATCAGG + Intergenic
1199245338 X:145598292-145598314 GTGGGTGGAGGGAGAGCATCAGG + Intergenic
1199476198 X:148248119-148248141 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1199655933 X:149995516-149995538 GTGGAGGGAGGGAGAGCATTAGG + Intergenic
1199821993 X:151458565-151458587 GTGGGAGGAGGGAGAGCATCAGG + Intergenic
1200367978 X:155688023-155688045 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1200384668 X:155878767-155878789 GTTGGGGGAGGGAGAGCATCAGG + Intergenic
1200530207 Y:4325198-4325220 GCGGAGGGAGGGAGAGCATCAGG + Intergenic
1200572576 Y:4851673-4851695 GTGGAAGGAGGGAGAGGATCAGG + Intergenic
1200596992 Y:5155454-5155476 GTGGGGTGAGGGAGAGCATCAGG - Intronic
1200638514 Y:5687036-5687058 GTGGTGGGAGGGAGAGCATCAGG + Intronic
1200677269 Y:6164290-6164312 GTGGGAAGAGGGAGAGGATCAGG + Intergenic
1200756337 Y:6993527-6993549 GTGGGGGGAGGGAGAGCATCAGG - Intronic
1201398410 Y:13575031-13575053 GTGGAAGGAGGGAGAGCATCAGG + Intergenic
1201423403 Y:13823867-13823889 GTAGGAAGAGGGAGAGCATCGGG + Intergenic