ID: 1055090179

View in Genome Browser
Species Human (GRCh38)
Location 9:72356443-72356465
Sequence CATCTACAGGAGTCGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055090179_1055090183 2 Left 1055090179 9:72356443-72356465 CCCTCTATCGACTCCTGTAGATG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1055090183 9:72356468-72356490 ACGCAGGATAAAATTTACACAGG No data
1055090179_1055090186 24 Left 1055090179 9:72356443-72356465 CCCTCTATCGACTCCTGTAGATG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1055090186 9:72356490-72356512 GCTCTGGAGTTAGGCTAAGCTGG No data
1055090179_1055090185 15 Left 1055090179 9:72356443-72356465 CCCTCTATCGACTCCTGTAGATG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1055090185 9:72356481-72356503 TTTACACAGGCTCTGGAGTTAGG No data
1055090179_1055090184 8 Left 1055090179 9:72356443-72356465 CCCTCTATCGACTCCTGTAGATG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1055090184 9:72356474-72356496 GATAAAATTTACACAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055090179 Original CRISPR CATCTACAGGAGTCGATAGA GGG (reversed) Intronic
911058354 1:93727060-93727082 CATGTACAAGAGTCAATGGAAGG - Intronic
1066683200 10:37955608-37955630 CTTCTACAGGAGTTAATAAAAGG + Intronic
1071754010 10:88515392-88515414 CATATACAAGAGCCCATAGATGG - Intronic
1077920410 11:6637794-6637816 CATCTTAAGGAGTTTATAGAGGG - Intronic
1080489208 11:32745056-32745078 CATTTAAAGCAGTGGATAGAGGG - Intronic
1086475460 11:87168456-87168478 CAGCTAAAGGAGTCTTTAGAGGG - Intronic
1089306747 11:117531206-117531228 CAGCTACAGGACCCCATAGAAGG - Intronic
1091158759 11:133399611-133399633 CAGCCAGAGGAGTGGATAGAGGG - Intronic
1101288370 12:103340201-103340223 GTTCTCCAGGAGTCTATAGAGGG + Intronic
1120045136 14:79797306-79797328 TATCTTCAGGAGTAGGTAGAGGG + Intronic
1140358448 16:74325245-74325267 CAGCTGCAGGAGACGAGAGATGG + Intergenic
1151172821 17:72261967-72261989 CAAATACAGGAGTAGACAGAGGG + Intergenic
926920932 2:17939245-17939267 CATTTACAGTAGTCAATAGAAGG + Intronic
939448159 2:142336085-142336107 CATACACAGGACTCCATAGAGGG - Intergenic
944413924 2:199464918-199464940 CACCTCCAGGAGCCGACAGAAGG + Intronic
946641284 2:221786030-221786052 CATCTACAGTAGCCCATGGAAGG + Intergenic
1172532790 20:35644851-35644873 CATTTACAGGAGTTGATCAAAGG + Intronic
955556481 3:60143232-60143254 CATATACAGGTGTGGATACAAGG - Intronic
969033434 4:4231259-4231281 CAACTACCGGAGACAATAGAAGG + Intergenic
970265060 4:14273413-14273435 CAACTACAAGAGTAGAAAGAAGG - Intergenic
971057206 4:22927126-22927148 CATCCACAGGAATTGAAAGACGG - Intergenic
982792782 4:159612573-159612595 CATTTAAAGCAGTCTATAGAGGG - Intergenic
982947825 4:161648350-161648372 CCTCTACAGGAGCATATAGATGG - Intronic
983449613 4:167894493-167894515 TATCTAGAGAAGTAGATAGAGGG + Intergenic
987552398 5:19400997-19401019 CTTTTACAGGAGACCATAGAGGG + Intergenic
995771669 5:115677169-115677191 CATCTACAGATGTCTGTAGATGG + Intergenic
1008573933 6:52841092-52841114 CATGTACAGGAGTTAATGGAAGG + Intronic
1009652346 6:66492020-66492042 CATTTAAAGGAGTCTTTAGAGGG + Intergenic
1009993046 6:70867158-70867180 CATCTAAAGGAGTGTTTAGATGG + Intronic
1010620154 6:78063833-78063855 CATCTACTGGAGTTGATCAAAGG + Intergenic
1037148535 8:15605418-15605440 CTTCTACAGGAGAAGATAAATGG - Intronic
1039291888 8:36104935-36104957 CATCTAAAGGAGTATTTAGAGGG + Intergenic
1051346067 9:16152275-16152297 CACCCACAGGAATAGATAGAAGG + Intergenic
1052213229 9:25932439-25932461 CATTTAAAGGAGTGTATAGAGGG - Intergenic
1055090179 9:72356443-72356465 CATCTACAGGAGTCGATAGAGGG - Intronic
1058366774 9:104218329-104218351 CATTTAAAGCAGTCTATAGAGGG - Intergenic
1186298617 X:8175555-8175577 GATCTACAGGAGGAGAAAGATGG + Intergenic
1189113442 X:38318549-38318571 TATCTAAAGGAGTAGACAGACGG + Intronic
1190327782 X:49217481-49217503 CCTCTACAGGAGTCTCAAGATGG + Intronic
1190397980 X:50003868-50003890 CATGTACAGGAGTCCTGAGAAGG - Intronic
1193160975 X:78229132-78229154 CATTTAAAGAAGTGGATAGAGGG - Intergenic
1199401012 X:147398231-147398253 CTTTTAAAGGAGTCGATAAATGG - Intergenic