ID: 1055090180

View in Genome Browser
Species Human (GRCh38)
Location 9:72356444-72356466
Sequence GCATCTACAGGAGTCGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055090180_1055090184 7 Left 1055090180 9:72356444-72356466 CCTCTATCGACTCCTGTAGATGC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1055090184 9:72356474-72356496 GATAAAATTTACACAGGCTCTGG No data
1055090180_1055090186 23 Left 1055090180 9:72356444-72356466 CCTCTATCGACTCCTGTAGATGC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1055090186 9:72356490-72356512 GCTCTGGAGTTAGGCTAAGCTGG No data
1055090180_1055090185 14 Left 1055090180 9:72356444-72356466 CCTCTATCGACTCCTGTAGATGC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1055090185 9:72356481-72356503 TTTACACAGGCTCTGGAGTTAGG No data
1055090180_1055090183 1 Left 1055090180 9:72356444-72356466 CCTCTATCGACTCCTGTAGATGC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1055090183 9:72356468-72356490 ACGCAGGATAAAATTTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055090180 Original CRISPR GCATCTACAGGAGTCGATAG AGG (reversed) Intronic
913574323 1:120155275-120155297 GCTTCTATAGGAGTGGAGAGGGG - Exonic
914295591 1:146320078-146320100 GCTTCTATAGGAGTGGAGAGGGG - Intergenic
914556631 1:148770859-148770881 GCTTCTATAGGAGTGGAGAGGGG - Intergenic
914616203 1:149359371-149359393 GCTTCTATAGGAGTGGAGAGGGG + Intergenic
917194494 1:172451010-172451032 GCATCTTGAGGAGTCGTGAGTGG - Intronic
917216781 1:172687137-172687159 GAATCTACAACAGTCTATAGTGG + Intergenic
1075597861 10:123745432-123745454 GCATCTCCAAGAGCCAATAGTGG + Intronic
1080317789 11:30970148-30970170 CCAACTACAGGAGTCTATTGTGG - Intronic
1085542488 11:77285332-77285354 GCATATACAGGATTTGGTAGGGG - Intronic
1089157294 11:116412269-116412291 GCATCAACAGGAGTCCAAGGGGG - Intergenic
1093762877 12:22929795-22929817 GCATCTCCAGGACTGGATTGGGG + Intergenic
1097450984 12:59736546-59736568 GCATCTGCAGCAGCTGATAGTGG - Intronic
1099874980 12:88393059-88393081 GCATCCACAGCAGTGGATGGGGG - Intergenic
1109211968 13:59545438-59545460 ACACCTACAGGAGTTGATGGGGG - Intergenic
1127776383 15:62267325-62267347 GAATCTACAGGAGGCGAAAAGGG + Intergenic
1134039267 16:11055497-11055519 GCAGCTACAGGAGAGGATGGTGG + Intronic
1139935436 16:70567402-70567424 TCTTCCACAGGAGTCTATAGAGG - Exonic
1140757783 16:78084091-78084113 CCATCATCAGGAGTAGATAGAGG - Intergenic
1156662746 18:39366242-39366264 GGTTGTACAGGAGTCTATAGTGG + Intergenic
1160817864 19:1044570-1044592 GCATCTGCAGGAGCCGCTGGGGG - Exonic
939247153 2:139640185-139640207 GCATCTATAGGAATCGCCAGAGG + Intergenic
939448160 2:142336086-142336108 GCATACACAGGACTCCATAGAGG - Intergenic
1174595394 20:51679485-51679507 GGATTTAAAGGAGTGGATAGTGG - Intronic
1176126046 20:63475278-63475300 GCATCGACAGGACTCCAGAGAGG + Intergenic
1177109147 21:17002989-17003011 GCATCTACAAGAGTCTAAAATGG - Intergenic
955015387 3:55064539-55064561 GCATGCACAGGAGTGGAGAGAGG - Intronic
966680645 3:182638374-182638396 GCATCTACAAGAGAGGAGAGAGG + Intergenic
969825989 4:9758830-9758852 GCATATCCAGGGGGCGATAGGGG - Intergenic
972083246 4:35181609-35181631 CCTTCCACAGGAGTCGTTAGGGG - Intergenic
1012090565 6:94889266-94889288 GCAACTAAAGCAGTCTATAGAGG - Intergenic
1014330300 6:120055764-120055786 GCATCCACAACAGTGGATAGGGG - Intergenic
1015346789 6:132169830-132169852 GCCTCTACAGAAGAGGATAGGGG - Intergenic
1027742662 7:82031232-82031254 GCATCTAAAGGAGCCTACAGTGG + Intronic
1039291887 8:36104934-36104956 GCATCTAAAGGAGTATTTAGAGG + Intergenic
1045734095 8:105275146-105275168 CCATCTCCAGGAGTGGATAATGG - Intronic
1049155809 8:141066041-141066063 GCATCAACAGGACTGGATTGAGG + Intergenic
1055090180 9:72356444-72356466 GCATCTACAGGAGTCGATAGAGG - Intronic
1057505521 9:95630325-95630347 GTTTCTCCAGGAGTCGAGAGGGG - Intergenic
1059543708 9:115155428-115155450 GCATCTACAGGGGCCAGTAGGGG + Intronic
1061065100 9:128272862-128272884 GAATCTACAGGAGGCGAAAAGGG + Intronic
1190254981 X:48755495-48755517 GCATCTACAGAAATCAATATTGG + Intergenic
1194162878 X:90476858-90476880 GCAGCTACAGCAGTACATAGAGG + Intergenic
1194410828 X:93555614-93555636 GCATCCACAACAGTCGACAGGGG - Intergenic
1200509153 Y:4054589-4054611 GCAGCTACAGCAGTACATAGAGG + Intergenic
1201053013 Y:9959353-9959375 GCATCTACAGGAAGCGGTGGGGG + Intergenic