ID: 1055090182

View in Genome Browser
Species Human (GRCh38)
Location 9:72356456-72356478
Sequence TTATCCTGCGTTGCATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055090182_1055090186 11 Left 1055090182 9:72356456-72356478 CCTGTAGATGCAACGCAGGATAA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1055090186 9:72356490-72356512 GCTCTGGAGTTAGGCTAAGCTGG No data
1055090182_1055090185 2 Left 1055090182 9:72356456-72356478 CCTGTAGATGCAACGCAGGATAA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1055090185 9:72356481-72356503 TTTACACAGGCTCTGGAGTTAGG No data
1055090182_1055090184 -5 Left 1055090182 9:72356456-72356478 CCTGTAGATGCAACGCAGGATAA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1055090184 9:72356474-72356496 GATAAAATTTACACAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055090182 Original CRISPR TTATCCTGCGTTGCATCTAC AGG (reversed) Intronic
903082632 1:20823141-20823163 TTATCCTGTATTGCATATATGGG + Intronic
904270553 1:29347232-29347254 TTATCATGTGTAGCATTTACAGG - Intergenic
906659201 1:47570667-47570689 TTATCCTGCTTGGCGTCTGCTGG + Intergenic
913070129 1:115290975-115290997 CTACCCTGCCTTGCATCTGCTGG + Intronic
916806746 1:168267397-168267419 TTATCTTACGTTGGAACTACAGG + Intergenic
917131897 1:171751627-171751649 TTTTTCTGCGTGTCATCTACTGG - Intergenic
1075487057 10:122831102-122831124 TGAACATGCATTGCATCTACAGG - Intergenic
1076758586 10:132588637-132588659 TTAGCCTGTGCTGCGTCTACAGG + Intronic
1076782433 10:132731639-132731661 TGAGCCTCCGTTGCATCTGCTGG + Intronic
1080639282 11:34149403-34149425 TGAGCATGGGTTGCATCTACAGG - Intergenic
1086606047 11:88697477-88697499 TGATCTTGCATTGCTTCTACAGG - Intronic
1092985259 12:13838843-13838865 TTATGCTGCTTTGCATCAGCAGG - Intronic
1099895472 12:88641163-88641185 TTTTCCTGCCTAGCATCTATTGG - Intergenic
1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG + Intronic
1122979291 14:105184476-105184498 TTCTCCTGCCTTGGATCTTCGGG - Intergenic
1128407029 15:67352784-67352806 TTATCCTGCTTTGTATTTATTGG + Intronic
1131029753 15:89176559-89176581 TCATCCTGTGGGGCATCTACTGG - Intronic
1134011048 16:10853385-10853407 TCATCCTCCGTGGCAGCTACAGG - Intergenic
1136491423 16:30610709-30610731 TTATCCTGAGTTCCTTTTACTGG + Intronic
1136986712 16:35113126-35113148 TGTCCCTGCATTGCATCTACAGG + Intergenic
1148536771 17:48445580-48445602 TTCTTCTGCTTTGCATCCACAGG + Intergenic
1161573548 19:5043331-5043353 TTATCCTGCGCAGCATTTATCGG + Intronic
935388016 2:102521661-102521683 TTGTCCTGAGTTGCATTTTCAGG - Intronic
935466442 2:103403898-103403920 TTATCGTTCATTGCATCTTCTGG + Intergenic
944509817 2:200453548-200453570 TTTTCCTGCCTTGCAACTAGTGG + Intronic
1170147602 20:13193945-13193967 CTAGCCTACCTTGCATCTACAGG - Intergenic
1174080877 20:47969881-47969903 TTCTCCTGAGTAGCATCTCCAGG - Intergenic
960601357 3:119462104-119462126 TTAACCTGGGTTGCAACTACAGG - Exonic
961302134 3:125929120-125929142 TTATCCTGCGTTTGGTCTCCAGG - Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
973658835 4:53081080-53081102 TAATCATGTGTTGCATTTACAGG - Intronic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
987434975 5:17883586-17883608 TTTTCCTGCGTAGAATCTAGGGG - Intergenic
992552235 5:77869689-77869711 TTATCCTGTTTTGCATTGACTGG - Intergenic
994651586 5:102535655-102535677 TTATCTTTCTTTGCATCTGCTGG + Intergenic
998214308 5:140225780-140225802 TTTTCCTGCCGTGAATCTACTGG + Intronic
1006412224 6:33880731-33880753 TTGTCCTGGGTTGCTTATACTGG + Intergenic
1017431059 6:154371195-154371217 TTATCCTTCTTGGCAGCTACTGG - Intronic
1020319783 7:6931121-6931143 TTATCCTGCGTTTGGTCTCCAGG + Intergenic
1022434397 7:30366926-30366948 TTATTGTGCTTTGCATCTCCAGG + Exonic
1022913457 7:34922317-34922339 TTATCCTACGTAGCAACTGCTGG + Intergenic
1039322015 8:36442616-36442638 TTATCCTGCTTGGGATATACTGG + Intergenic
1042683666 8:71414107-71414129 TTATCCTGAGTAGGAGCTACAGG + Intronic
1053380441 9:37644956-37644978 TCATTCTGCTTTGCATCTGCTGG - Intronic
1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG + Intronic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1058378691 9:104355042-104355064 TTCTCCTGCATTCCATCTCCAGG + Intergenic
1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG + Intergenic
1196879213 X:120183526-120183548 CTATCCTGCGTTACAACTTCAGG - Intergenic
1202096397 Y:21252754-21252776 TTATTCTGCATTGCATTTATTGG + Intergenic