ID: 1055090186

View in Genome Browser
Species Human (GRCh38)
Location 9:72356490-72356512
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055090179_1055090186 24 Left 1055090179 9:72356443-72356465 CCCTCTATCGACTCCTGTAGATG 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1055090186 9:72356490-72356512 GCTCTGGAGTTAGGCTAAGCTGG No data
1055090180_1055090186 23 Left 1055090180 9:72356444-72356466 CCTCTATCGACTCCTGTAGATGC 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1055090186 9:72356490-72356512 GCTCTGGAGTTAGGCTAAGCTGG No data
1055090182_1055090186 11 Left 1055090182 9:72356456-72356478 CCTGTAGATGCAACGCAGGATAA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1055090186 9:72356490-72356512 GCTCTGGAGTTAGGCTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr