ID: 1055090875

View in Genome Browser
Species Human (GRCh38)
Location 9:72364421-72364443
Sequence GCGTGCCGCCTCTGCGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055090875_1055090886 24 Left 1055090875 9:72364421-72364443 CCGGCCCCGCAGAGGCGGCACGC 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1055090886 9:72364468-72364490 GTGGAGCGAGCCAGGGACGCCGG 0: 1
1: 0
2: 0
3: 17
4: 196
1055090875_1055090885 17 Left 1055090875 9:72364421-72364443 CCGGCCCCGCAGAGGCGGCACGC 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1055090885 9:72364461-72364483 CCGTGCTGTGGAGCGAGCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1055090875_1055090883 16 Left 1055090875 9:72364421-72364443 CCGGCCCCGCAGAGGCGGCACGC 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1055090883 9:72364460-72364482 ACCGTGCTGTGGAGCGAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1055090875_1055090880 5 Left 1055090875 9:72364421-72364443 CCGGCCCCGCAGAGGCGGCACGC 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1055090880 9:72364449-72364471 ATTGTTTCCCGACCGTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 31
1055090875_1055090887 25 Left 1055090875 9:72364421-72364443 CCGGCCCCGCAGAGGCGGCACGC 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1055090887 9:72364469-72364491 TGGAGCGAGCCAGGGACGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055090875 Original CRISPR GCGTGCCGCCTCTGCGGGGC CGG (reversed) Intronic
901641178 1:10694002-10694024 ACGGGCCGCTCCTGCGGGGCGGG - Intronic
902622000 1:17656126-17656148 GAGAGCAGCCTCTGCAGGGCTGG + Intronic
902768748 1:18633488-18633510 GCCTGCAGGCTCTGCGAGGCTGG - Intronic
902823161 1:18955885-18955907 GCGAGCCGCCGCCGGGGGGCAGG + Exonic
904094641 1:27967324-27967346 GCGGGACGCCTGTGCTGGGCCGG + Exonic
904304306 1:29577678-29577700 GCGGGCAGCCTCTGTGGGACTGG + Intergenic
908523394 1:64966129-64966151 GCCCGCCGGCTCCGCGGGGCTGG + Intronic
909898968 1:81109301-81109323 GCCTGGCTGCTCTGCGGGGCGGG - Intergenic
912977833 1:114346198-114346220 GCGCGCCCCCACTGCAGGGCAGG - Intergenic
913975361 1:143450992-143451014 GCAAGCCGCCACTGAGGGGCTGG + Intergenic
914069751 1:144276608-144276630 GCAAGCCGCCACTGAGGGGCTGG + Intergenic
914109404 1:144689746-144689768 GCAAGCCGCCACTGAGGGGCTGG - Intergenic
914919963 1:151839808-151839830 GCATCCCGCGTCTGCAGGGCGGG + Intronic
915272147 1:154760869-154760891 GCGGGGCGCCTTTGCGGGGCCGG - Intronic
924732570 1:246724946-246724968 AGGTGCCCCCGCTGCGGGGCAGG - Intronic
924957691 1:248945026-248945048 GCGCGCCGCCTTTGCGAGGGCGG + Intergenic
1063449931 10:6144699-6144721 GCGGGCCGCCCCTGCGGGACCGG + Intergenic
1072021817 10:91410228-91410250 GGGAGCCGCGTCCGCGGGGCTGG + Intergenic
1075645454 10:124093304-124093326 GCGCGCCGCCTCCGCCGGCCCGG + Intronic
1076771046 10:132665037-132665059 GCGCCCCGCCTGTGCAGGGCAGG + Intronic
1076963539 10:133786540-133786562 GCGCGCCGCCTTTGCGAGGGCGG + Intergenic
1077144244 11:1037593-1037615 ACGTGCCACGTCTGAGGGGCCGG + Intergenic
1078066227 11:8081141-8081163 GGGTGGGGTCTCTGCGGGGCGGG + Intronic
1080628352 11:34051592-34051614 GCGGGCGGCCTCTTCCGGGCAGG + Intergenic
1080774603 11:35373652-35373674 GGGTGCCCCATCTGCTGGGCAGG + Intronic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1083922269 11:65787299-65787321 CCGTCCCACCTTTGCGGGGCCGG - Exonic
1083934110 11:65861388-65861410 GCAAGTCGCCCCTGCGGGGCTGG - Exonic
1084161681 11:67353622-67353644 GCAGGCCGCCTATGCGGGGCGGG + Intronic
1090859950 11:130644205-130644227 GCGGGCCGCCTCTGCAGCTCAGG + Intergenic
1091688993 12:2583141-2583163 GCGCGGCGCCGCTGCGGGCCCGG - Intronic
1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG + Intergenic
1103309016 12:119989681-119989703 GCGTGCCGCCGGCGCGGGGGAGG + Intergenic
1104912299 12:132245116-132245138 GCCTGACTCCTCCGCGGGGCAGG - Intronic
1104944738 12:132410522-132410544 GGGTGGGGCCTCTGCAGGGCCGG + Intergenic
1104961382 12:132490021-132490043 GCGGGCCGCGTGTGCGGGGTGGG + Exonic
1108359966 13:49659960-49659982 GCCTGCAGCCTCTGCAGGGTAGG + Intergenic
1112402181 13:99086670-99086692 CCGGGCCGCCTCCTCGGGGCGGG + Intergenic
1112520361 13:100089274-100089296 CCGTGCCGCCTCTGGGCGGCTGG + Intronic
1113494151 13:110714388-110714410 GAGGGCCGCCGCTGCGGAGCCGG - Intronic
1113613630 13:111665550-111665572 GCTGGGCCCCTCTGCGGGGCTGG + Intronic
1113989975 13:114353419-114353441 GCGCGCCGCCTTTGCGAGGGCGG + Intergenic
1122541359 14:102499459-102499481 GCCTGCAGCCTCAGAGGGGCAGG + Exonic
1122999837 14:105287416-105287438 GAGGGCCGACGCTGCGGGGCGGG - Intronic
1126800908 15:52295696-52295718 GCGCCCGGCCTCTGCGGCGCAGG - Exonic
1127267958 15:57376442-57376464 GCGGGCGGCGACTGCGGGGCGGG + Intronic
1128893458 15:71351705-71351727 GCGTGGCCTCTCTGCTGGGCTGG + Intronic
1129447177 15:75626447-75626469 GGGTGTAGCCTCTGCAGGGCGGG + Intronic
1131107544 15:89745131-89745153 CCCTGCTGCCTCTGCTGGGCCGG - Intergenic
1131712325 15:95069139-95069161 GCGTACGGCCTCTGTGTGGCTGG - Intergenic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1136266695 16:29125335-29125357 GTGTGCCGCCTCTTCGAGGGTGG + Intergenic
1136690675 16:32025919-32025941 GCCAACCGCCTCTGCAGGGCAGG + Intergenic
1136791260 16:32969480-32969502 GCCAACCGCCTCTGCAGGGCAGG + Intergenic
1136878554 16:33884452-33884474 GCCAACCGCCTCTGCAGGGCAGG - Intergenic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1141441687 16:84033418-84033440 GCGTACCACGGCTGCGGGGCGGG + Exonic
1142290152 16:89190409-89190431 GGGTGCCCCCTCTGCTAGGCTGG - Exonic
1142312400 16:89321485-89321507 GGGAGCCGCAGCTGCGGGGCAGG + Intronic
1142375037 16:89702158-89702180 GCGGGCCTCCCCTGTGGGGCGGG + Intergenic
1203093469 16_KI270728v1_random:1230942-1230964 GCCAACCGCCTCTGCAGGGCAGG + Intergenic
1143016516 17:3893469-3893491 GAGTGTAGCTTCTGCGGGGCGGG + Intronic
1144759704 17:17700432-17700454 GCGCGCAGCCCCTGCGGGGGTGG + Intronic
1145059696 17:19724813-19724835 GCTCGCCGCCCCTGAGGGGCTGG - Intergenic
1145878141 17:28335343-28335365 GCGCGCTGCCGCCGCGGGGCCGG - Exonic
1147153539 17:38532062-38532084 GCCAACCGCCTCTGCAGGGCAGG + Exonic
1148686959 17:49506460-49506482 GCGTGCCGCGTGTGCGAGGCGGG + Exonic
1148911999 17:50947795-50947817 GCGTTGCTCCTCTGTGGGGCTGG + Intergenic
1150621657 17:66812312-66812334 CCCTGCTGCCTCTGTGGGGCCGG - Intergenic
1152341679 17:79729184-79729206 GGGTGCCTGCTCTGCAGGGCTGG - Intergenic
1152617164 17:81343296-81343318 GCGGGCGGCCTCCGCCGGGCCGG - Intergenic
1154315436 18:13300243-13300265 GCCGGCCCCCTCTGCGGGCCTGG - Intronic
1154349736 18:13572961-13572983 GCATGCCTGCTCTGTGGGGCTGG + Intronic
1155811358 18:30239762-30239784 TCCTGCAGCCTCTGTGGGGCAGG - Intergenic
1158648860 18:59269289-59269311 TCGGGCCGCCGCTGCCGGGCGGG - Exonic
1159057071 18:63476865-63476887 GAGTGCCGCCGAGGCGGGGCGGG + Exonic
1160439601 18:78879299-78879321 GCGTGACGCCCCTTCGGGGACGG - Intergenic
1160633385 18:80262854-80262876 GCGCGCCGCCTTTGCGAGGATGG + Intergenic
1160895917 19:1401691-1401713 CGGTGCCCCCTCTGCGGAGCGGG + Intergenic
1160909679 19:1468869-1468891 GTGTGGCGCTTCTGGGGGGCTGG - Exonic
1162895977 19:13764859-13764881 GCGCCCCGCACCTGCGGGGCAGG - Exonic
1165060928 19:33204913-33204935 GGGTGCCGCCCCTGTGGGCCGGG - Intronic
1166001024 19:39877604-39877626 GGGTCCCGTCTCTTCGGGGCTGG - Intronic
1166739496 19:45105367-45105389 GCTTGCCCTCTCTGTGGGGCAGG + Intronic
1168269551 19:55242092-55242114 GAGACCCGCCTCTGAGGGGCCGG + Intronic
1168728750 19:58607251-58607273 GCGCGCCGCCTTTGCGAGGGCGG + Intergenic
925202501 2:1979826-1979848 GTGAGCCGCCCCTGCAGGGCTGG - Intronic
925492702 2:4412752-4412774 GGTTGACGCCTCTGCGGGCCAGG - Intergenic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
934180061 2:89611965-89611987 GCAAGCCGCCACTGAGGGGCTGG + Intergenic
934290354 2:91686226-91686248 GCAAGCCGCCACTGAGGGGCTGG + Intergenic
936016502 2:108963091-108963113 GTTTGCGGCCTCTGCAGGGCTGG - Intronic
936151196 2:110023264-110023286 GCCTGCCGCCTCTGTGAAGCGGG - Intergenic
936193479 2:110348105-110348127 GCCTGCCGCCTCTGTGAAGCGGG + Intergenic
936569828 2:113603704-113603726 GCGCGCCGCCTTTGCGAGGGCGG - Intergenic
938060793 2:128252764-128252786 GCCTGCCCTCTCTTCGGGGCTGG - Intronic
942147439 2:173040473-173040495 GCTGGCAGCCTCTGTGGGGCTGG + Intronic
943119062 2:183711076-183711098 ACGTGCTGCCTCTGCTGGGATGG + Intergenic
944070145 2:195658113-195658135 GCGCACCGCCTCTCCGGGTCTGG + Intronic
946029762 2:216694724-216694746 GCTGGCCGCCTATGCGGGGCCGG - Exonic
1174305432 20:49611313-49611335 GCGGGCTACCTGTGCGGGGCAGG + Intergenic
1176952506 21:15064444-15064466 GCGTGGCCCCTGAGCGGGGCCGG - Intronic
1180264225 21:46699319-46699341 GCGCGCCGCCTTTGCGAGGGCGG + Intergenic
1180960592 22:19760704-19760726 GCGGGGCGCCTCCTCGGGGCCGG + Intronic
1185217462 22:49609664-49609686 GCGTGACGCGTCCACGGGGCGGG + Intronic
1185313717 22:50170172-50170194 CCGCGCCGCATCTGCGTGGCGGG + Intergenic
1185418466 22:50722174-50722196 CCACGCCGCCTCTGCCGGGCTGG + Intergenic
1185430386 22:50807265-50807287 GCGCGCCGCCTTTGCGAGGGCGG + Intergenic
950316219 3:12004286-12004308 CGGGGCCGCCTCTGCGGCGCGGG + Intergenic
950408176 3:12817373-12817395 GCTTGCCGCCTCTTGGGGACAGG - Exonic
951543926 3:23806899-23806921 GCGGGGCGCCACGGCGGGGCAGG - Intronic
953031229 3:39181068-39181090 GCGTGCCGCCGAGGAGGGGCGGG - Intergenic
953561235 3:43995337-43995359 GGGTACCGCCTGCGCGGGGCAGG - Intergenic
956677994 3:71753580-71753602 GCGGGATGCCTCGGCGGGGCTGG + Intronic
957270666 3:78026292-78026314 GCGTGCAGACTCTGGGTGGCTGG + Intergenic
961368550 3:126416052-126416074 GCGTGCCCCCTCTGTGGGTCTGG + Intronic
961655364 3:128438806-128438828 GCATGAGGCCTCTGTGGGGCAGG + Intergenic
962422474 3:135240615-135240637 GCATTCCACCTCTGGGGGGCAGG - Intronic
968676413 4:1883333-1883355 GTGTACCCCCTCTGCAGGGCTGG + Intronic
968756130 4:2417515-2417537 GCCAGCAGCCTCGGCGGGGCGGG - Intronic
968764737 4:2462499-2462521 GCGTGCAGCAGCTGCGGCGCAGG + Exonic
968820130 4:2843912-2843934 GCGGGCCGCTGCTGCGGGCCAGG + Exonic
969583579 4:8079390-8079412 GCCTGCCGCCTGCACGGGGCTGG + Intronic
969829220 4:9781665-9781687 GCAAGCCGCCACTGAGGGGCTGG - Exonic
985466793 4:190203983-190204005 GCGCGCCGCCTTTGCGAGGGCGG + Intergenic
985720500 5:1486267-1486289 GGGTGCCGCCTCTGAGGTGGGGG - Intronic
985895471 5:2748279-2748301 GCGCTCCGCCTCCCCGGGGCTGG + Intronic
987050471 5:14143769-14143791 GCTGGCCGCCGCGGCGGGGCCGG - Exonic
995841434 5:116446803-116446825 GAGTCCACCCTCTGCGGGGCGGG + Exonic
1002277440 5:178113387-178113409 GTGCGGCGCCTCTGCGGGTCAGG + Intergenic
1002348032 5:178561524-178561546 GCGTTCCTCATCTGTGGGGCAGG - Intronic
1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG + Intronic
1003645593 6:7910840-7910862 GGGCGCGGCCTCTCCGGGGCGGG - Intronic
1003683516 6:8278622-8278644 GAGTGCAGCCTCTGCGTGGAAGG - Intergenic
1010001778 6:70956252-70956274 CCGGGCCGCCCCTGCGGAGCGGG + Exonic
1011514997 6:88144510-88144532 CCGTGCTGCCTCTCCTGGGCTGG - Exonic
1015551484 6:134416748-134416770 GGGTCCCTCCTCTGCGGCGCAGG - Intergenic
1019327304 7:444767-444789 GCGCGCCACCTCTGCAGAGCTGG - Intergenic
1022536585 7:31102280-31102302 GCAGGCCACATCTGCGGGGCAGG + Intronic
1031921855 7:127608284-127608306 GCATGCCGGCTGTGGGGGGCAGG + Intergenic
1034188231 7:149195509-149195531 GCCTTCCCCCTCTCCGGGGCCGG - Exonic
1034414067 7:150955782-150955804 GAGTGCGGCCGCTGCTGGGCTGG - Intronic
1034447896 7:151122819-151122841 ACATGCCCCCTGTGCGGGGCCGG + Intronic
1039936523 8:42051455-42051477 GCGTGCCGGCTGTGCCGGGCCGG - Intronic
1045583116 8:103500431-103500453 GCGCGCCGCCTCGGAGGGGAAGG - Intergenic
1048009244 8:130443240-130443262 GCGGCCAGGCTCTGCGGGGCCGG - Intronic
1049166385 8:141128581-141128603 GCGAGCGCCGTCTGCGGGGCGGG - Intronic
1049687145 8:143943553-143943575 GCCTGCAGCCTGTGCGGGACAGG - Intronic
1049694458 8:143976644-143976666 GCGTGCGGGCGCTGCGGGGTGGG - Intronic
1053409142 9:37904265-37904287 GCAGGCCGCCGCGGCGGGGCAGG + Intronic
1055090875 9:72364421-72364443 GCGTGCCGCCTCTGCGGGGCCGG - Intronic
1060527840 9:124330539-124330561 CCGTGCTGCCTCTTGGGGGCTGG + Intronic
1060996569 9:127877575-127877597 GGGGGGCGCCTCTGCGGGGAGGG - Intronic
1195610584 X:106862912-106862934 GTGTGCTACCTCTGCGGGGCTGG + Intronic
1199595871 X:149505328-149505350 GCGTCCCTCCCCTCCGGGGCGGG + Intronic
1199996770 X:153030790-153030812 CCCTGCCGTCTCTGGGGGGCTGG + Intergenic
1200252666 X:154562004-154562026 GGGTGCTCCCTCTGTGGGGCTGG + Intronic
1200265101 X:154642412-154642434 GGGTGCTCCCTCTGTGGGGCTGG - Intergenic