ID: 1055090912

View in Genome Browser
Species Human (GRCh38)
Location 9:72364568-72364590
Sequence GCCGCGGATGGCGGCGTCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055090912_1055090922 5 Left 1055090912 9:72364568-72364590 CCCCGGACGCCGCCATCCGCGGC 0: 1
1: 0
2: 2
3: 16
4: 134
Right 1055090922 9:72364596-72364618 CCGGCTTCGCCATTGGCCCGCGG 0: 1
1: 0
2: 1
3: 2
4: 44
1055090912_1055090919 -2 Left 1055090912 9:72364568-72364590 CCCCGGACGCCGCCATCCGCGGC 0: 1
1: 0
2: 2
3: 16
4: 134
Right 1055090919 9:72364589-72364611 GCCTGCTCCGGCTTCGCCATTGG 0: 1
1: 0
2: 1
3: 9
4: 65
1055090912_1055090923 13 Left 1055090912 9:72364568-72364590 CCCCGGACGCCGCCATCCGCGGC 0: 1
1: 0
2: 2
3: 16
4: 134
Right 1055090923 9:72364604-72364626 GCCATTGGCCCGCGGCGCCCCGG 0: 1
1: 0
2: 2
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055090912 Original CRISPR GCCGCGGATGGCGGCGTCCG GGG (reversed) Exonic
900555058 1:3276257-3276279 GGCGAGGATGGCGGGGGCCGGGG - Intronic
903656835 1:24954694-24954716 TCCGTGGATGGCCACGTCCGTGG - Intronic
904050450 1:27635116-27635138 GCCGCGAGTGCCGGCGTGCGGGG + Exonic
905408745 1:37754061-37754083 GCCCCGGAAGGCGGCGTACGGGG - Intronic
905553016 1:38859323-38859345 GCCCGGGAGGGCGGCGGCCGGGG - Intronic
906027241 1:42683301-42683323 GCCGCGGCGGCCGGCGTGCGAGG + Intronic
906206909 1:43991853-43991875 GCCGGGGACGGCGGCGTCGGTGG + Exonic
915902369 1:159855952-159855974 TCCGGGGCTGGCGGCGCCCGCGG - Exonic
922503120 1:226110859-226110881 GCCGGGGATGGCGGGGCCTGGGG + Intergenic
1070327749 10:75399495-75399517 GGCGCAGCTGGCGGCGGCCGCGG - Exonic
1072679951 10:97499128-97499150 TCAGCGGACGGCGGCGTCCCGGG - Exonic
1072731489 10:97849952-97849974 GGCGGGGATGGGGGCGGCCGGGG - Intergenic
1076707190 10:132308290-132308312 GCCCCGGAGGTCGGCGTCCCTGG + Intronic
1076793184 10:132787238-132787260 GCGGAGGAAGGCGGCGCCCGGGG + Intergenic
1081699968 11:45146777-45146799 GCCTCGGCTGGCGGCCCCCGCGG - Intronic
1081927873 11:46845942-46845964 GGCGCGGGTGGCAGCGTCCGCGG - Intronic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1084667094 11:70582325-70582347 GCCGGGGCTGGCGGCCTCCACGG - Intronic
1089442797 11:118530919-118530941 GCCGCGGACCCGGGCGTCCGCGG + Exonic
1090189382 11:124758578-124758600 GCCGCGTAGGGCAGGGTCCGCGG - Intronic
1091335433 11:134762565-134762587 GCTGAGGATGGCGGCAGCCGCGG + Intergenic
1091335441 11:134762594-134762616 GCTGAGGATGGCGGCGGCCATGG + Intergenic
1093958640 12:25250432-25250454 GCCGCGGCTGGAGGCTTCTGGGG - Intronic
1095581656 12:43806584-43806606 GCAGCGAATGGCGGCGTCGGCGG - Intergenic
1096284135 12:50283536-50283558 GCGGCGGTGGGCGGGGTCCGGGG - Intronic
1096675040 12:53221692-53221714 GCCGCTGCTGGCGCTGTCCGGGG - Intronic
1097046263 12:56189558-56189580 GCGGCGGGAGGCGGCGGCCGCGG - Intronic
1098342978 12:69470626-69470648 GGCTCGGCTGCCGGCGTCCGGGG + Intronic
1101940959 12:109098471-109098493 GGCGAGGAGGGCGGCGTCCCAGG - Exonic
1102053623 12:109880433-109880455 GGCGCTGACGGCGGCGGCCGGGG - Exonic
1103649607 12:122422523-122422545 GCGGCGACCGGCGGCGTCCGAGG - Exonic
1104444716 12:128823871-128823893 GCGGCGGGCGGCGGCGGCCGCGG - Exonic
1104841541 12:131828284-131828306 GGCGGGGGTGGCAGCGTCCGAGG + Intergenic
1108555218 13:51584738-51584760 GCAGCGGATGGAGGGGTCCCAGG + Exonic
1111976000 13:94967953-94967975 GCCGCGGAGGGTGGCGCCTGGGG + Intergenic
1122418373 14:101560974-101560996 GCCGCGGGAGGCCGGGTCCGCGG - Intergenic
1122889105 14:104724431-104724453 GCTGATGATGTCGGCGTCCGTGG - Intronic
1125677585 15:41511211-41511233 GCCGCGGCCGGCGGCTTCGGGGG - Exonic
1125685043 15:41559067-41559089 GCTGCTGACGGCGGCGACCGCGG + Exonic
1132527660 16:425730-425752 GCGGCGGATGGCGGGGGACGGGG - Exonic
1132578717 16:675611-675633 GCCGCGCGTGGCGGCGTGTGCGG + Intronic
1132588197 16:715267-715289 GGCACGGCGGGCGGCGTCCGGGG - Exonic
1132840166 16:1974978-1975000 CACGCGGATGGCGGCATCCGTGG - Exonic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1134523669 16:14929321-14929343 ATCGCGGATGGTGGCGTCCCAGG + Intronic
1134549229 16:15131615-15131637 ATCGCGGATGGTGGCGTCCCAGG - Intronic
1134696985 16:16232533-16232555 GCGGCGGCTGGCGGCGGCGGTGG + Exonic
1134711261 16:16327806-16327828 ATCGCGGATGGTGGCGTCCCAGG + Intergenic
1134955568 16:18380887-18380909 ATCGCGGATGGTGGCGTCCCAGG - Intergenic
1136873007 16:33825084-33825106 GTCGGGAATGGCGGCCTCCGTGG + Intergenic
1139761425 16:69187360-69187382 GCCGTTGAAGGCGGCGGCCGCGG - Exonic
1140091939 16:71846026-71846048 GCCGGGGATGGCGGCGGCCGCGG + Exonic
1141531242 16:84648472-84648494 GCGGCCAATGGCGGCGGCCGCGG - Intergenic
1203099165 16_KI270728v1_random:1290971-1290993 GTCGGGAATGGCGGCCTCCGTGG - Intergenic
1142699345 17:1649777-1649799 GCCCAGGAGGGCGGCGCCCGGGG - Exonic
1144816494 17:18039144-18039166 GCGGAAGATGGCGGCGTCCAAGG - Exonic
1146370982 17:32265713-32265735 GGCCCGGGTGGCGGCGCCCGGGG + Intergenic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1150692363 17:67377453-67377475 GCCGAGGTTGGAGGCGCCCGGGG + Intronic
1152617841 17:81346040-81346062 GCCCCGGAGGGCGGCGGCCGCGG - Intergenic
1154202469 18:12308620-12308642 GGCGCGGGTGGCGGCGTCCCGGG + Intronic
1156502018 18:37566137-37566159 GCCACGGCGGGCGGCGGCCGGGG + Intergenic
1157464291 18:47930764-47930786 GCCGCGGCGGCCGGCGGCCGAGG - Intronic
1158920725 18:62187937-62187959 GCCGGGGATGGGGGCGCCAGGGG + Exonic
1160540379 18:79617446-79617468 CCCGGGGAGGGCGGCGTCCCGGG - Intergenic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160859766 19:1232843-1232865 GCCCCGGATGGTGGTGTTCGTGG - Intronic
1160882055 19:1325366-1325388 GCGGCGGGGGGCGGCGGCCGGGG + Intergenic
1160897028 19:1407869-1407891 GCCCCGGGGGGCGGCGTCTGAGG - Intronic
1160988003 19:1848422-1848444 GGCGCGGGCGGCGGCGACCGCGG - Exonic
1161108781 19:2456974-2456996 GCCGCGGCGGGCGGCGGGCGCGG - Exonic
1161215796 19:3094554-3094576 GCCGCGGCGGGCGGCGGCCGAGG + Exonic
1161286689 19:3472084-3472106 ACCGAGGATGGGGGGGTCCGAGG + Intergenic
1161384854 19:3985433-3985455 GCCGAGGATGGCGGCGACGACGG + Exonic
1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG + Intronic
1163026886 19:14517884-14517906 GCCGCGGGAGGAGGCGCCCGGGG + Intronic
1163513096 19:17747771-17747793 GCCGCAGGTGGCGGCGAGCGCGG + Exonic
1163602928 19:18259514-18259536 GCCTCGGATGGTGGAGCCCGGGG + Intronic
1167469970 19:49670220-49670242 GCTGCGCAGGGCGGGGTCCGAGG - Exonic
1168309351 19:55452702-55452724 GCCGGGGGTGGCGGCGTGGGGGG + Intergenic
927794280 2:26034402-26034424 GCCTCCGAGGGCGGCGACCGCGG - Exonic
931395917 2:61888449-61888471 GCCGGGGCTGCCGGCGGCCGCGG - Exonic
932331666 2:70901394-70901416 GACGCGGAGGGTGGCGTGCGCGG + Intronic
936561225 2:113541570-113541592 GCCCCGGAGGGCGGCGAGCGCGG + Intergenic
936713607 2:115161418-115161440 ACCGCGGAAGCCGGCGGCCGTGG + Intronic
948449632 2:238061048-238061070 GGCGGGGATGGAGGCGGCCGTGG + Exonic
1169065592 20:2692865-2692887 GCGGCGGGCGGCGGCGGCCGCGG + Exonic
1171473492 20:25390373-25390395 GGCGCGGACGGGGGCGGCCGCGG + Intronic
1172951201 20:38724436-38724458 GCTGCGGAGGGCGGCGGCGGCGG - Intergenic
1175429119 20:58890292-58890314 GCCGAGGAGGGCGCCGTCGGGGG + Intronic
1175856310 20:62122653-62122675 GCCGCTCATGGCGGCGGCCGGGG - Exonic
1176029533 20:63005283-63005305 GCAGCGGATGGCGGCGGGGGGGG + Intergenic
1176219292 20:63962464-63962486 GCCGCAGATGGCGGGGGCAGCGG + Intronic
1179605619 21:42513744-42513766 GCCGGGGGTCGCGGCGGCCGGGG + Intronic
1179674904 21:42974739-42974761 GCGGCGGCGGGCGGCGGCCGCGG - Intronic
1180258177 21:46648655-46648677 GCCGAGGCTGGTGACGTCCGAGG + Intronic
1181813709 22:25421138-25421160 GGCGCGGCGGGCGGCGGCCGCGG + Intergenic
1183665568 22:39244120-39244142 GCCGGGGGCGGCGGCGCCCGGGG - Exonic
1183715779 22:39532687-39532709 GGAGCTGCTGGCGGCGTCCGAGG - Exonic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
954004205 3:47578822-47578844 GCGGCGGACGGCGGCGGCGGCGG - Exonic
955911548 3:63863834-63863856 GCGGCGGTTGGCGGCGGCGGAGG + Exonic
963906757 3:150779358-150779380 GACGCCGATGGCGGCGCCCTCGG - Intergenic
966872300 3:184299064-184299086 GCCTCCGAGGGCGGGGTCCGAGG + Exonic
966878938 3:184338850-184338872 GGCACGGATGGCGGCGGCTGAGG + Intronic
968952978 4:3704095-3704117 GCCGTGGCTGGCGGCTTCCTGGG + Intergenic
970456225 4:16226561-16226583 GCCGCGGATGGCGGCGGCGGCGG - Intronic
971351804 4:25862603-25862625 GACGCGGGTGGGGGCGGCCGGGG - Intronic
974000342 4:56505716-56505738 GCCGGGGTTGGCAGCGCCCGCGG + Intronic
974385731 4:61200904-61200926 GCCGCCGAGGGCTGCGTCCCGGG - Intergenic
983940161 4:173529185-173529207 GCAGCGGCTGGCGGCGGCGGCGG + Exonic
985791696 5:1931584-1931606 CCCGCGGGTGGCGGCGGCTGTGG - Intergenic
986072123 5:4295847-4295869 GCCCCGGCTGGCGGTCTCCGTGG - Intergenic
990553809 5:56909952-56909974 GCCGAGGTTGGTGGAGTCCGAGG + Intronic
1004044701 6:12012489-12012511 GCTGCTGATGGCGGCGGCCGCGG - Exonic
1007739704 6:44003070-44003092 GCCGCGGATGACAGCGGCGGTGG - Exonic
1014272188 6:119348484-119348506 CTCGCGGATGGCGGCGTCGGCGG + Exonic
1018613397 6:165663270-165663292 GGCGCGGAAGGCGGCGGCGGCGG - Intronic
1019306725 7:338979-339001 GACGAGGATGGCAGCGTCCAGGG + Intergenic
1021313171 7:19117137-19117159 GCCGCGGGTGGGGGCGTCGGAGG - Exonic
1021614393 7:22487554-22487576 GCCGAGGATGGCGGGGGCGGGGG + Intronic
1023937268 7:44748878-44748900 GGCGCGGGTGGCGGCGGCCCCGG + Intronic
1024606664 7:51027690-51027712 GGTGAGGATGGCGGCTTCCGGGG - Exonic
1025992485 7:66506279-66506301 GCCGAGGCGGGCGGCGACCGAGG - Intergenic
1027262787 7:76477012-76477034 GCCGATGATGGAGGCGGCCGTGG + Intronic
1027314163 7:76975109-76975131 GCCGATGATGGAGGCGGCCGTGG + Intergenic
1027333207 7:77121776-77121798 GGCGTGGAGGGCGGCGTGCGGGG - Intergenic
1029459516 7:100686976-100686998 GCTGCTGAGGGCGGCGGCCGGGG - Intronic
1029461139 7:100694373-100694395 GCCGCGGAGGGAGGCGGCGGCGG - Intergenic
1029782585 7:102749526-102749548 GGCGTGGAGGGCGGCGTGCGGGG + Exonic
1033253110 7:139777556-139777578 GCCGCGGAGGGCGGCGGGCGCGG + Intronic
1035167445 7:157000057-157000079 GCCGCGGATGGGGGAGCCCGGGG + Intronic
1035629795 8:1098607-1098629 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629808 8:1098644-1098666 GGCGTGGGTGGCGGCGTCCGTGG - Intergenic
1035629822 8:1098681-1098703 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629836 8:1098718-1098740 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629850 8:1098755-1098777 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629863 8:1098792-1098814 GGAGTGGGTGGCGGCGTCCGTGG - Intergenic
1037935470 8:22912515-22912537 GCCCCGGATGGCAGCTTCCCTGG - Intronic
1039484359 8:37899477-37899499 GCCGCGACTGGCGGCCTCCACGG + Intergenic
1039591915 8:38756957-38756979 TCCGCGGATCGCGGAGTCCCGGG + Intronic
1042271595 8:66961688-66961710 GTCGCGGATGGCGGCGGCCAGGG + Exonic
1049891462 9:73746-73768 GCCCCGGAGGGCGGCGAGCGCGG - Intergenic
1053435019 9:38068741-38068763 GCCCCGGCGGGGGGCGTCCGGGG + Exonic
1054695539 9:68356711-68356733 GCCCCGGAGGGCGGCGATCGCGG + Intronic
1055090912 9:72364568-72364590 GCCGCGGATGGCGGCGTCCGGGG - Exonic
1061248424 9:129413387-129413409 GCCGCGGCGGGCGGGGGCCGGGG - Intergenic
1061320317 9:129824034-129824056 GCTGCTGCTGGCGCCGTCCGTGG - Exonic
1062325699 9:136011553-136011575 GCCGCGGCCGCCGGCGTCTGGGG + Exonic
1189244932 X:39556007-39556029 GCCGCTGCTGGCTGCGTCCTGGG - Intergenic
1192924995 X:75747054-75747076 GCGGCGGATGCCTGCGTCCCAGG - Intergenic
1194765298 X:97842089-97842111 AGCGCGGATGGCGGAGGCCGAGG - Intergenic
1201223017 Y:11789687-11789709 GCCGCTGATGGGGGCGGACGGGG + Intergenic