ID: 1055091299

View in Genome Browser
Species Human (GRCh38)
Location 9:72366322-72366344
Sequence TAGGAATCTTTAATCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055091299_1055091311 18 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091311 9:72366363-72366385 GGTTTTGGTTGTTCCGGGGTGGG No data
1055091299_1055091308 13 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091308 9:72366358-72366380 GATATGGTTTTGGTTGTTCCGGG No data
1055091299_1055091310 17 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091310 9:72366362-72366384 TGGTTTTGGTTGTTCCGGGGTGG No data
1055091299_1055091300 -9 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091300 9:72366336-72366358 AGATTCCTACGCATCTCCCCTGG No data
1055091299_1055091307 12 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091307 9:72366357-72366379 GGATATGGTTTTGGTTGTTCCGG No data
1055091299_1055091316 29 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091316 9:72366374-72366396 TTCCGGGGTGGGAGCGGGGGTGG No data
1055091299_1055091309 14 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091309 9:72366359-72366381 ATATGGTTTTGGTTGTTCCGGGG No data
1055091299_1055091303 3 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091303 9:72366348-72366370 ATCTCCCCTGGATATGGTTTTGG No data
1055091299_1055091317 30 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091317 9:72366375-72366397 TCCGGGGTGGGAGCGGGGGTGGG No data
1055091299_1055091302 -3 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091302 9:72366342-72366364 CTACGCATCTCCCCTGGATATGG No data
1055091299_1055091314 25 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091314 9:72366370-72366392 GTTGTTCCGGGGTGGGAGCGGGG No data
1055091299_1055091313 24 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091313 9:72366369-72366391 GGTTGTTCCGGGGTGGGAGCGGG No data
1055091299_1055091315 26 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091315 9:72366371-72366393 TTGTTCCGGGGTGGGAGCGGGGG No data
1055091299_1055091312 23 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091312 9:72366368-72366390 TGGTTGTTCCGGGGTGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055091299 Original CRISPR TAGGAATCTTTAATCACCCC AGG (reversed) Intergenic
No off target data available for this crispr