ID: 1055091300

View in Genome Browser
Species Human (GRCh38)
Location 9:72366336-72366358
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055091299_1055091300 -9 Left 1055091299 9:72366322-72366344 CCTGGGGTGATTAAAGATTCCTA No data
Right 1055091300 9:72366336-72366358 AGATTCCTACGCATCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055091300 Original CRISPR AGATTCCTACGCATCTCCCC TGG Intergenic
No off target data available for this crispr