ID: 1055093363

View in Genome Browser
Species Human (GRCh38)
Location 9:72385451-72385473
Sequence AGTTCAGGTAGTAGATGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055093363_1055093367 12 Left 1055093363 9:72385451-72385473 CCTCGACATCTACTACCTGAACT No data
Right 1055093367 9:72385486-72385508 TAAGTGCTAAGTACCATCGTTGG No data
1055093363_1055093371 20 Left 1055093363 9:72385451-72385473 CCTCGACATCTACTACCTGAACT No data
Right 1055093371 9:72385494-72385516 AAGTACCATCGTTGGGGAGAGGG No data
1055093363_1055093369 14 Left 1055093363 9:72385451-72385473 CCTCGACATCTACTACCTGAACT No data
Right 1055093369 9:72385488-72385510 AGTGCTAAGTACCATCGTTGGGG No data
1055093363_1055093368 13 Left 1055093363 9:72385451-72385473 CCTCGACATCTACTACCTGAACT No data
Right 1055093368 9:72385487-72385509 AAGTGCTAAGTACCATCGTTGGG No data
1055093363_1055093372 21 Left 1055093363 9:72385451-72385473 CCTCGACATCTACTACCTGAACT No data
Right 1055093372 9:72385495-72385517 AGTACCATCGTTGGGGAGAGGGG No data
1055093363_1055093370 19 Left 1055093363 9:72385451-72385473 CCTCGACATCTACTACCTGAACT No data
Right 1055093370 9:72385493-72385515 TAAGTACCATCGTTGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055093363 Original CRISPR AGTTCAGGTAGTAGATGTCG AGG (reversed) Intergenic
No off target data available for this crispr