ID: 1055093364

View in Genome Browser
Species Human (GRCh38)
Location 9:72385466-72385488
Sequence TTAGTATGTTGAGGGAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055093364_1055093369 -1 Left 1055093364 9:72385466-72385488 CCTGAACTCCCTCAACATACTAA No data
Right 1055093369 9:72385488-72385510 AGTGCTAAGTACCATCGTTGGGG No data
1055093364_1055093371 5 Left 1055093364 9:72385466-72385488 CCTGAACTCCCTCAACATACTAA No data
Right 1055093371 9:72385494-72385516 AAGTACCATCGTTGGGGAGAGGG No data
1055093364_1055093367 -3 Left 1055093364 9:72385466-72385488 CCTGAACTCCCTCAACATACTAA No data
Right 1055093367 9:72385486-72385508 TAAGTGCTAAGTACCATCGTTGG No data
1055093364_1055093370 4 Left 1055093364 9:72385466-72385488 CCTGAACTCCCTCAACATACTAA No data
Right 1055093370 9:72385493-72385515 TAAGTACCATCGTTGGGGAGAGG No data
1055093364_1055093372 6 Left 1055093364 9:72385466-72385488 CCTGAACTCCCTCAACATACTAA No data
Right 1055093372 9:72385495-72385517 AGTACCATCGTTGGGGAGAGGGG No data
1055093364_1055093368 -2 Left 1055093364 9:72385466-72385488 CCTGAACTCCCTCAACATACTAA No data
Right 1055093368 9:72385487-72385509 AAGTGCTAAGTACCATCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055093364 Original CRISPR TTAGTATGTTGAGGGAGTTC AGG (reversed) Intergenic
No off target data available for this crispr