ID: 1055093367

View in Genome Browser
Species Human (GRCh38)
Location 9:72385486-72385508
Sequence TAAGTGCTAAGTACCATCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055093363_1055093367 12 Left 1055093363 9:72385451-72385473 CCTCGACATCTACTACCTGAACT No data
Right 1055093367 9:72385486-72385508 TAAGTGCTAAGTACCATCGTTGG No data
1055093364_1055093367 -3 Left 1055093364 9:72385466-72385488 CCTGAACTCCCTCAACATACTAA No data
Right 1055093367 9:72385486-72385508 TAAGTGCTAAGTACCATCGTTGG No data
1055093362_1055093367 18 Left 1055093362 9:72385445-72385467 CCTTGTCCTCGACATCTACTACC No data
Right 1055093367 9:72385486-72385508 TAAGTGCTAAGTACCATCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055093367 Original CRISPR TAAGTGCTAAGTACCATCGT TGG Intergenic
No off target data available for this crispr