ID: 1055093372

View in Genome Browser
Species Human (GRCh38)
Location 9:72385495-72385517
Sequence AGTACCATCGTTGGGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055093364_1055093372 6 Left 1055093364 9:72385466-72385488 CCTGAACTCCCTCAACATACTAA No data
Right 1055093372 9:72385495-72385517 AGTACCATCGTTGGGGAGAGGGG No data
1055093363_1055093372 21 Left 1055093363 9:72385451-72385473 CCTCGACATCTACTACCTGAACT No data
Right 1055093372 9:72385495-72385517 AGTACCATCGTTGGGGAGAGGGG No data
1055093362_1055093372 27 Left 1055093362 9:72385445-72385467 CCTTGTCCTCGACATCTACTACC No data
Right 1055093372 9:72385495-72385517 AGTACCATCGTTGGGGAGAGGGG No data
1055093366_1055093372 -3 Left 1055093366 9:72385475-72385497 CCTCAACATACTAAGTGCTAAGT No data
Right 1055093372 9:72385495-72385517 AGTACCATCGTTGGGGAGAGGGG No data
1055093365_1055093372 -2 Left 1055093365 9:72385474-72385496 CCCTCAACATACTAAGTGCTAAG No data
Right 1055093372 9:72385495-72385517 AGTACCATCGTTGGGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055093372 Original CRISPR AGTACCATCGTTGGGGAGAG GGG Intergenic
No off target data available for this crispr