ID: 1055095449

View in Genome Browser
Species Human (GRCh38)
Location 9:72408689-72408711
Sequence GAAATTACCCCGGCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055095449_1055095453 -2 Left 1055095449 9:72408689-72408711 CCACACCCAGCCGGGGTAATTTC No data
Right 1055095453 9:72408710-72408732 TCAATAGCTATTACGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055095449 Original CRISPR GAAATTACCCCGGCTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr