ID: 1055095453

View in Genome Browser
Species Human (GRCh38)
Location 9:72408710-72408732
Sequence TCAATAGCTATTACGACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055095451_1055095453 -8 Left 1055095451 9:72408695-72408717 CCAGCCGGGGTAATTTCAATAGC No data
Right 1055095453 9:72408710-72408732 TCAATAGCTATTACGACCACAGG No data
1055095449_1055095453 -2 Left 1055095449 9:72408689-72408711 CCACACCCAGCCGGGGTAATTTC No data
Right 1055095453 9:72408710-72408732 TCAATAGCTATTACGACCACAGG No data
1055095448_1055095453 1 Left 1055095448 9:72408686-72408708 CCACCACACCCAGCCGGGGTAAT No data
Right 1055095453 9:72408710-72408732 TCAATAGCTATTACGACCACAGG No data
1055095443_1055095453 29 Left 1055095443 9:72408658-72408680 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1055095453 9:72408710-72408732 TCAATAGCTATTACGACCACAGG No data
1055095450_1055095453 -7 Left 1055095450 9:72408694-72408716 CCCAGCCGGGGTAATTTCAATAG No data
Right 1055095453 9:72408710-72408732 TCAATAGCTATTACGACCACAGG No data
1055095444_1055095453 28 Left 1055095444 9:72408659-72408681 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1055095453 9:72408710-72408732 TCAATAGCTATTACGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055095453 Original CRISPR TCAATAGCTATTACGACCAC AGG Intergenic
No off target data available for this crispr