ID: 1055097441

View in Genome Browser
Species Human (GRCh38)
Location 9:72427917-72427939
Sequence ATATTGTTATAGGTACTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055097441_1055097445 10 Left 1055097441 9:72427917-72427939 CCATGAAGTACCTATAACAATAT No data
Right 1055097445 9:72427950-72427972 CCATTCTGACTCAAAGGCTCAGG No data
1055097441_1055097446 11 Left 1055097441 9:72427917-72427939 CCATGAAGTACCTATAACAATAT No data
Right 1055097446 9:72427951-72427973 CATTCTGACTCAAAGGCTCAGGG No data
1055097441_1055097443 4 Left 1055097441 9:72427917-72427939 CCATGAAGTACCTATAACAATAT No data
Right 1055097443 9:72427944-72427966 ATGAAGCCATTCTGACTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055097441 Original CRISPR ATATTGTTATAGGTACTTCA TGG (reversed) Intergenic
No off target data available for this crispr