ID: 1055101797

View in Genome Browser
Species Human (GRCh38)
Location 9:72473236-72473258
Sequence AGGCAAATCCTGCTACTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055101790_1055101797 28 Left 1055101790 9:72473185-72473207 CCACCTTCTTCAGTTTTACACCA No data
Right 1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG No data
1055101794_1055101797 8 Left 1055101794 9:72473205-72473227 CCAAGGGTGCAGAATCTTTAACT No data
Right 1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG No data
1055101789_1055101797 29 Left 1055101789 9:72473184-72473206 CCCACCTTCTTCAGTTTTACACC No data
Right 1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG No data
1055101791_1055101797 25 Left 1055101791 9:72473188-72473210 CCTTCTTCAGTTTTACACCAAGG No data
Right 1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG No data
1055101788_1055101797 30 Left 1055101788 9:72473183-72473205 CCCCACCTTCTTCAGTTTTACAC No data
Right 1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055101797 Original CRISPR AGGCAAATCCTGCTACTCAC TGG Intergenic
No off target data available for this crispr