ID: 1055107019

View in Genome Browser
Species Human (GRCh38)
Location 9:72523611-72523633
Sequence TTGAATAGGCTGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055107014_1055107019 -7 Left 1055107014 9:72523595-72523617 CCTTGTCATCTTCAAGTTGAATA 0: 1
1: 5
2: 45
3: 143
4: 427
Right 1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055107019 Original CRISPR TTGAATAGGCTGAAGGAGGA GGG Intronic
No off target data available for this crispr