ID: 1055107174

View in Genome Browser
Species Human (GRCh38)
Location 9:72525274-72525296
Sequence AAGTAGGACAGGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055107167_1055107174 28 Left 1055107167 9:72525223-72525245 CCAAGTCAGCATCTGTTTGCATC 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055107174 Original CRISPR AAGTAGGACAGGAGGGCAGC TGG Intronic
No off target data available for this crispr