ID: 1055117717

View in Genome Browser
Species Human (GRCh38)
Location 9:72623670-72623692
Sequence CAGCACTAACAGCTGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055117717_1055117720 11 Left 1055117717 9:72623670-72623692 CCATGTATCAGCTGTTAGTGCTG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1055117720 9:72623704-72623726 TATCATGAAGGTAATTTCCCAGG No data
1055117717_1055117718 -1 Left 1055117717 9:72623670-72623692 CCATGTATCAGCTGTTAGTGCTG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1055117718 9:72623692-72623714 GTGTGTATTCCATATCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055117717 Original CRISPR CAGCACTAACAGCTGATACA TGG (reversed) Intronic
901344192 1:8524464-8524486 CACCACTAAGAGCTTACACAAGG + Intronic
901353634 1:8622455-8622477 CAGCACTGACACCTGAAATACGG - Intronic
902113540 1:14102689-14102711 CAGCCATAAGAGCTAATACACGG - Intergenic
902391056 1:16106762-16106784 CAGCACTACCAGCTGTGGCAGGG + Intergenic
902879490 1:19361803-19361825 CAGAATTAACAGCACATACATGG + Intronic
906654595 1:47538449-47538471 CAGCACAAACAGCTCACAGAGGG - Intergenic
911119265 1:94278961-94278983 AAGTACTAACATCTGATGCATGG + Intergenic
921300850 1:213750202-213750224 CAGCACAGCCAGCTGATACTTGG + Intergenic
1068563542 10:58545144-58545166 CAGCACTAGCAACTAATACAAGG + Intronic
1069800086 10:71076561-71076583 CTGCAGTGACAGCTGAGACAGGG - Intergenic
1071785806 10:88898510-88898532 CAGGACCATCAGCTAATACATGG + Intronic
1071909941 10:90220184-90220206 AAGCACTAACAGCTGCGACCTGG - Intergenic
1074926814 10:118081650-118081672 TAGCAATAATAGCTAATACAGGG - Intergenic
1075486547 10:122827064-122827086 CAGCTCAGACAGCAGATACATGG - Intergenic
1079344849 11:19642917-19642939 CAGAACTACCACCTGATGCAAGG - Intronic
1079647155 11:22879722-22879744 CAGTACTAGCAGCTGCTTCAGGG - Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1092748466 12:11695606-11695628 CAGAACTAACAGATGAAACCCGG - Intronic
1092864498 12:12748085-12748107 AAGCAGTCACAGCTGATGCAAGG + Intronic
1093190215 12:16065648-16065670 CATTCCTAACACCTGATACATGG + Intergenic
1100401703 12:94236316-94236338 CAGCACACACAGGTGCTACACGG - Intronic
1103150615 12:118635508-118635530 CAGCACAAACACCTGGCACATGG - Intergenic
1103189903 12:118992468-118992490 CAGAACTTCCAGCTGATAAAGGG + Intronic
1103806472 12:123577546-123577568 CAGGACAAACAGCTGGCACATGG - Intergenic
1104285596 12:127421660-127421682 CAGCAGGAAGAGCAGATACACGG - Intergenic
1105657210 13:22454390-22454412 CAGCTCTGGCAGCTGATTCAGGG - Intergenic
1107345658 13:39458056-39458078 CAGTAATAACAGCTGATTCTGGG + Intronic
1107858744 13:44641008-44641030 AAGCACTAACAGCTCATATTTGG - Intergenic
1108441024 13:50452932-50452954 CAGCACTAACAGATGTTGCAAGG - Intronic
1108533256 13:51346824-51346846 CAGCACAAGGAGCTGAGACAGGG + Intronic
1108798438 13:54062967-54062989 CATCACTAAAACATGATACATGG - Intergenic
1109137186 13:58667354-58667376 CAGCACTAGGTGCTGATACATGG + Intergenic
1115314970 14:32015848-32015870 TAGAACTAACAGCTAATATATGG + Intronic
1116076840 14:40121497-40121519 AATGACTAACAGCTGATTCAAGG + Intergenic
1118002605 14:61537582-61537604 GAGCACTAACCTCTGAGACAAGG - Intronic
1118812093 14:69282588-69282610 CTGCACTTAGAGCAGATACAGGG - Intronic
1119170221 14:72529292-72529314 CAGCAGTAATAGCAGATCCAAGG - Intronic
1119687555 14:76644804-76644826 CAGCCCTCACAGCTGAGGCAGGG + Intergenic
1123634004 15:22284716-22284738 CAGCACTGACACCTGAAATACGG + Intergenic
1126101585 15:45121162-45121184 CAGCACCAACACATCATACAAGG - Exonic
1130420894 15:83745946-83745968 CAACACTAATAACTGATAGAGGG - Intronic
1130929678 15:88414718-88414740 GAGCAAAAACAGATGATACAAGG + Intergenic
1131243815 15:90772727-90772749 CCCCAGTAACAGCTGTTACAAGG + Intronic
1138176184 16:54900253-54900275 CAACAATAACAGCTGATAGAAGG - Intergenic
1141451944 16:84109813-84109835 CATCACTACCATCTGATCCACGG - Intronic
1141769327 16:86079696-86079718 CCCCACAAACAGCTGAGACAAGG + Intergenic
1145780586 17:27560401-27560423 CAGCAGTAAGAGCTTATTCAGGG - Intronic
1156023895 18:32630130-32630152 CAGCTCAAGCAGCTGAGACAGGG + Intergenic
1159090041 18:63837736-63837758 CAGCAATAACAGCTGTTTCAGGG - Intergenic
1159395782 18:67854036-67854058 CAGCATAAACAGGTGAAACAGGG - Intergenic
1160360013 18:78267211-78267233 CAGCAATTTCATCTGATACATGG - Intergenic
1161523341 19:4738270-4738292 CAGCAATTACAGCTAATAAACGG - Intergenic
1162283127 19:9716488-9716510 CAGCACTACCAGCTGTGGCAGGG + Intergenic
1164767587 19:30783707-30783729 CAGCTCTAACAGCTATCACACGG - Intergenic
1166163999 19:40973797-40973819 CAGCACTAACAGCACACACAGGG - Intergenic
925747267 2:7054144-7054166 CAGCTCAAGCAGCTGAGACAAGG + Intronic
928865341 2:35910974-35910996 CAGCAATAGCTGCAGATACAAGG + Intergenic
929874031 2:45781605-45781627 CATCACCAGCAGCTGATGCAGGG + Intronic
931682579 2:64764004-64764026 TAGCACAAACAGCAGGTACATGG + Intergenic
934556683 2:95290213-95290235 CAGCACTCAGGGCTGACACAGGG - Exonic
935455795 2:103266378-103266400 AAGGACTAATAGCTCATACAAGG + Intergenic
936897891 2:117448758-117448780 CAGAACTCACAGCTGACCCATGG - Intergenic
936918097 2:117660748-117660770 AAGGACTAACAGCTGATGCTTGG + Intergenic
938712414 2:133986915-133986937 CAGTATGAACGGCTGATACAAGG - Intergenic
939892060 2:147748013-147748035 TAGCACTTACAGCACATACAGGG - Intergenic
940686764 2:156860608-156860630 AAACACAAACAGCTGATACCAGG - Intergenic
943737665 2:191374611-191374633 CAGCACTTCCAGCTGGTACTGGG - Intronic
944513068 2:200483713-200483735 CAACAGGAATAGCTGATACAGGG + Intergenic
946281559 2:218669658-218669680 CAGCTCTACCAAGTGATACATGG + Intronic
946882953 2:224194507-224194529 AAGCACTAAGAAATGATACAGGG + Intergenic
1169403688 20:5305269-5305291 CAGCACTACCAGCTGTGTCAGGG - Intronic
1169543525 20:6627713-6627735 CAGTACTTACAGCTGATGCTGGG + Intergenic
1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG + Intronic
1182012210 22:27010353-27010375 CAGCCCTAGAAACTGATACAGGG - Intergenic
1183728155 22:39600844-39600866 CAGCACTGCCAGCGGATACTGGG + Intronic
949621279 3:5814471-5814493 CAGCACTACCAGAAAATACATGG - Intergenic
950709698 3:14805440-14805462 CATCACTATCAGCTGATCCCAGG + Intergenic
952584203 3:34871675-34871697 CAGCTGTAACACCTGGTACAAGG + Intergenic
953414045 3:42705457-42705479 CAGCACTGACAGGTGAGACCTGG - Intronic
955037892 3:55286534-55286556 CAGCACTAACAGATACTTCATGG + Intergenic
956284185 3:67591223-67591245 GAGCACAAACAGCGCATACAAGG + Intronic
956788232 3:72660491-72660513 CAGAACTATGAGCTAATACATGG - Intergenic
958414802 3:93861032-93861054 GAGCATTAACAGATGATAAAAGG - Intergenic
961503330 3:127352853-127352875 CAACACTAAGGGCTGATTCAAGG + Intergenic
961590929 3:127981253-127981275 CAGGATTGACAGCTGATACATGG - Intronic
962969587 3:140386521-140386543 CAGCTCAAGCAGCTGAGACAGGG - Intronic
964874317 3:161348572-161348594 TAGCACCAACAGTGGATACATGG + Intronic
966761495 3:183423215-183423237 CAGTACCAACAGCTGAGGCATGG + Intronic
966808725 3:183825516-183825538 CAGCACAGGCGGCTGATACAGGG + Exonic
970996892 4:22278046-22278068 CAGAACTAAGAGCTGATAATGGG + Intergenic
977785047 4:101023036-101023058 CAGGAAAAACAGCTGATGCAGGG + Intergenic
978365431 4:107976262-107976284 AGTAACTAACAGCTGATACACGG + Intergenic
986208008 5:5644341-5644363 CAGCCCTAACAGATGAGCCATGG - Intergenic
990547500 5:56837469-56837491 CAGGACTAACAGTGGATACTTGG + Intronic
994258074 5:97624152-97624174 AAGCACTAACAACAGACACACGG + Intergenic
994343959 5:98663469-98663491 CATCACTACCAGCTCACACAGGG - Intergenic
997508681 5:134438097-134438119 CAGCACAAACTGCTGATTCATGG + Intergenic
998538870 5:142960534-142960556 CAGATCAAACAGCAGATACAGGG + Intronic
1000175442 5:158747919-158747941 CAGCAGTAAGAGCTGAACCAGGG + Intronic
1003172308 6:3729476-3729498 CAGCCCTACCAGGTGGTACAGGG - Intronic
1003294440 6:4811905-4811927 CAACACTAAGAGCTGATGAATGG - Intronic
1006059981 6:31412362-31412384 CAGCAGCAACAGCAGAAACATGG - Exonic
1007229609 6:40339228-40339250 GAGCTCTCACTGCTGATACAGGG + Intergenic
1008816694 6:55577191-55577213 CAGCACTAACATCTGACACTTGG - Intronic
1008866902 6:56223063-56223085 CAGCAATAAAAGCTTATCCAGGG - Intronic
1009796036 6:68469283-68469305 TATCACTTACAGCTGATATAAGG - Intergenic
1017854963 6:158342718-158342740 CAGAACTAACAACTGATTCAAGG - Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1022302987 7:29119184-29119206 AAGCATTAAGAGCAGATACAGGG + Intronic
1024035614 7:45505381-45505403 CAGCACTAAAAGCTCATTGATGG + Intergenic
1024778727 7:52821568-52821590 CAGCACCCACAGCTGTTTCATGG + Intergenic
1030273530 7:107695282-107695304 CAGAAATAAAAGCGGATACAAGG + Intronic
1033501000 7:141949550-141949572 CAGCATCAACAGCTGATCCTGGG - Intronic
1035495903 7:159325888-159325910 CAGAACTTACAGGTGATATAAGG - Intergenic
1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG + Intronic
1038121244 8:24618460-24618482 CAACACACACAGCTGATATAAGG - Intergenic
1038386745 8:27155714-27155736 ATTCACTCACAGCTGATACAGGG - Intergenic
1042446471 8:68890676-68890698 CAGCACTACCAGCTGTGGCAGGG - Intergenic
1042669995 8:71250904-71250926 CAACACTAACAGCTAATGAAAGG - Intronic
1044286517 8:90416717-90416739 CCTCACTGACAGCTGATAGATGG + Intergenic
1046024872 8:108710641-108710663 CAGCTCAAGCAGCTGAGACAAGG - Intronic
1052338867 9:27345814-27345836 CAGCACACACTGCTGAGACAGGG + Intronic
1052514040 9:29456933-29456955 CAGAACTCACAGTTAATACAGGG + Intergenic
1055117717 9:72623670-72623692 CAGCACTAACAGCTGATACATGG - Intronic
1055825649 9:80321159-80321181 AAGATCTCACAGCTGATACATGG - Intergenic
1059514387 9:114879356-114879378 CAGCAGTTACAGCCGATAGATGG + Intergenic
1060256912 9:122039253-122039275 CAACAATAACAGCAGATACCTGG + Exonic
1062151535 9:135021688-135021710 CAGCACCAGCAGCTGCTCCATGG - Intergenic
1188969086 X:36591167-36591189 CAGAAGCAACAGCTGAAACAGGG + Intergenic
1192247263 X:69384114-69384136 CAGCACTCACAGCTGGGAGATGG - Intergenic
1197998588 X:132407825-132407847 CAGAATTAACAGCTGATGGAGGG + Intronic
1198107420 X:133474822-133474844 CAGCACAAAAAGCAGATAGAAGG - Intergenic
1202305383 Y:23464383-23464405 CAGCACTGACACCTGAAATACGG + Intergenic
1202565426 Y:26206206-26206228 CAGCACTGACACCTGAAATACGG - Intergenic