ID: 1055117717

View in Genome Browser
Species Human (GRCh38)
Location 9:72623670-72623692
Sequence CAGCACTAACAGCTGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055117717_1055117720 11 Left 1055117717 9:72623670-72623692 CCATGTATCAGCTGTTAGTGCTG No data
Right 1055117720 9:72623704-72623726 TATCATGAAGGTAATTTCCCAGG No data
1055117717_1055117718 -1 Left 1055117717 9:72623670-72623692 CCATGTATCAGCTGTTAGTGCTG No data
Right 1055117718 9:72623692-72623714 GTGTGTATTCCATATCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055117717 Original CRISPR CAGCACTAACAGCTGATACA TGG (reversed) Intronic