ID: 1055122025

View in Genome Browser
Species Human (GRCh38)
Location 9:72671517-72671539
Sequence ATTCCATTTTACCACCTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055122025_1055122028 18 Left 1055122025 9:72671517-72671539 CCATAAAGGTGGTAAAATGGAAT 0: 1
1: 0
2: 0
3: 15
4: 229
Right 1055122028 9:72671558-72671580 ATCCAAAAGAAGGCTGAAAGAGG No data
1055122025_1055122027 8 Left 1055122025 9:72671517-72671539 CCATAAAGGTGGTAAAATGGAAT 0: 1
1: 0
2: 0
3: 15
4: 229
Right 1055122027 9:72671548-72671570 AAGTCAATTCATCCAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055122025 Original CRISPR ATTCCATTTTACCACCTTTA TGG (reversed) Intronic
907509118 1:54945463-54945485 ATTCCATTATTCCAACTGTAGGG - Intergenic
909841034 1:80324354-80324376 ATTCCATTTGGCCTCCTCTATGG + Intergenic
910203243 1:84721965-84721987 CTTCGATTTTCCCACCTTTCTGG - Intergenic
911382602 1:97134555-97134577 ATGCCATTTTACCAAGTTTGGGG + Intronic
912229191 1:107772932-107772954 ATTCCATTTTATTTCCTTTCTGG - Intronic
914227412 1:145732345-145732367 ATGTCATTTTATCCCCTTTATGG - Intronic
914798896 1:150945397-150945419 ATTCCATTTTTCCAGGGTTAAGG + Intronic
916284458 1:163090199-163090221 ATTCATTTTTACCACTTTTTTGG + Intergenic
917055286 1:170975010-170975032 ATTCCATTTTAGCTCCATTTTGG - Intronic
920893299 1:210015965-210015987 ATTCCATTATTGCACCTTTTAGG + Intronic
921577190 1:216849255-216849277 AGTGCATTGTACTACCTTTATGG - Intronic
922552391 1:226505520-226505542 ATTCCCTGTCACCACCTTTAGGG + Intergenic
922866514 1:228865431-228865453 TTACCACTTTACCACCTCTATGG - Intergenic
924506247 1:244687633-244687655 ATTCCATTTTACCTGCTTCCAGG + Intronic
1063199874 10:3777641-3777663 TTTCATTTTTACCTCCTTTATGG + Exonic
1063684924 10:8227874-8227896 ATACCATTTTACCAGCTTCATGG - Intergenic
1066194590 10:33086592-33086614 ATTCCATTTTTCCTCCTTCTGGG - Intergenic
1068262076 10:54595409-54595431 ATTCTATTTTATGACCTTGAGGG - Intronic
1068634384 10:59332371-59332393 ATTTCATTTTAAAACATTTAAGG + Intronic
1069158358 10:65056272-65056294 ATATAATTTTACCACCTTTTTGG + Intergenic
1069252257 10:66283570-66283592 ATTTCATTTTAACTCCTCTAAGG + Intronic
1069687316 10:70326528-70326550 CTTCCATTTTTCCATCTTCAGGG + Intronic
1070166787 10:73904935-73904957 TTTACATCTTAACACCTTTAAGG - Intergenic
1072016760 10:91355180-91355202 ATTGGATTTTACAACGTTTATGG - Intergenic
1073109184 10:101050632-101050654 ACTCCATTTTTCCCCCTGTAAGG + Intergenic
1073946630 10:108758166-108758188 ATTCCAATGTACCACCTAGATGG + Intergenic
1074387860 10:113031257-113031279 ATTCCATTTTACTTCCTCAAAGG - Intronic
1078229179 11:9423199-9423221 ATGCAATTTTTCAACCTTTATGG - Intronic
1083107954 11:60376670-60376692 TTTCCATTTTACTAGCTTCATGG + Intronic
1087021944 11:93611748-93611770 ACATCATTTTACCACCTTTTTGG + Intergenic
1093424841 12:19016971-19016993 ATTCCATTTTTCTCCCTTTTGGG + Intergenic
1093686500 12:22060825-22060847 ATGCCATTTTTCCACCCTAAAGG - Exonic
1093820844 12:23615950-23615972 ATTACCTTTTTCCACCATTATGG - Intronic
1095100730 12:38180368-38180390 ATTCTGTTTTACCATATTTAGGG - Intergenic
1095686278 12:45038608-45038630 ATTTTATTTTCCCACTTTTAGGG - Intronic
1095686290 12:45038690-45038712 ATTTTATTTTCCCACTTTTAGGG - Intronic
1095741630 12:45613326-45613348 ATTCAATGTTAACTCCTTTATGG - Intergenic
1099334830 12:81342041-81342063 GTTCCATTTTACTACCATGATGG + Intronic
1106039941 13:26080208-26080230 ATTCCATCTTGCCATCTTTCTGG - Intergenic
1106746386 13:32712871-32712893 ATATCTTTTTACCAACTTTACGG + Intronic
1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG + Intergenic
1107813816 13:44226016-44226038 GTTCCATTCTACCATCTTTATGG + Intergenic
1108121559 13:47193555-47193577 ATTCCATTTTTCCAGTTTTCTGG + Intergenic
1108366696 13:49723142-49723164 ATTCAGTTTTAACAACTTTACGG + Intronic
1109019290 13:57064834-57064856 ATCCCATTTTACTAACTTTCAGG - Intergenic
1109257908 13:60106030-60106052 ATTCCATATTGCCACTCTTAGGG - Intronic
1109811893 13:67524332-67524354 ATTCCATTTTTTAACCTTAAGGG + Intergenic
1109865109 13:68253979-68254001 ATTCCATGTTACCTCCTAGAGGG + Intergenic
1109918331 13:69021453-69021475 AATCCAATATACCATCTTTAGGG - Intergenic
1110400692 13:75087974-75087996 TTGTCATTTTACCTCCTTTAGGG - Intergenic
1115091690 14:29584495-29584517 ATTAGATTTTAGCTCCTTTAAGG + Intronic
1116214439 14:41993138-41993160 ATACTATTTTCCCACATTTAAGG - Intergenic
1116934063 14:50719445-50719467 ATTTCATGTTGCCATCTTTAGGG - Intergenic
1117910051 14:60628250-60628272 ATTTCATATTAACACTTTTATGG + Intergenic
1117931691 14:60849724-60849746 TTTCCATTGTACCACCAGTAAGG + Intronic
1118004414 14:61552932-61552954 ATTCTATTTTTCCACCTTTGTGG + Intronic
1119450922 14:74709646-74709668 ATGCCATGCTACCACATTTAGGG + Intronic
1119847138 14:77839110-77839132 ACTACATTTTATCTCCTTTAGGG - Intronic
1120520813 14:85526327-85526349 CTTACATTTTTCCACCATTATGG - Intergenic
1120921894 14:89762845-89762867 ATTCAATGTCACCACCTTTTGGG + Intergenic
1122320822 14:100854760-100854782 TTTCCATTTTCCCACCTCTTAGG + Intergenic
1124464629 15:29925733-29925755 CTTCCATTTTTACAGCTTTATGG + Intronic
1125622348 15:41075193-41075215 ATTCCATTTTATAACCTGGATGG + Intronic
1127430251 15:58899599-58899621 CTTCCTTCTTACCATCTTTATGG + Exonic
1128375393 15:67070805-67070827 CTGCCATTTTACCACCTGCAAGG + Intronic
1128404695 15:67323572-67323594 ATTCCATTTTAAATCTTTTATGG + Intronic
1130736299 15:86553814-86553836 ATTCCTTTCTAGCAACTTTATGG + Intronic
1130961285 15:88660077-88660099 ATTCCATTCTCCCAATTTTAGGG + Intergenic
1131859663 15:96639107-96639129 ATTCCATTTTCCTTCCCTTAGGG + Intergenic
1135291859 16:21246631-21246653 TTTCCATTTTACCAGCTACATGG - Intronic
1138034021 16:53584237-53584259 ATTCCATATCAGCACATTTAAGG + Intergenic
1138036011 16:53607008-53607030 ATTCCTTCGTACCACCTTGAAGG - Intronic
1138171712 16:54856724-54856746 ATTCCATTCTTCCACTTTTCTGG - Intergenic
1138317084 16:56079382-56079404 ATTCCATTTTAGTGACTTTAAGG - Intergenic
1139163454 16:64538574-64538596 ATTGAATTTTACCCCCTTTCTGG + Intergenic
1139409601 16:66748906-66748928 AATCTTTCTTACCACCTTTATGG + Intronic
1140128921 16:72140840-72140862 AATCCATGTTACCAGCTTTTTGG + Intronic
1140393142 16:74605778-74605800 ATTCTATTTGTCCACCTTTAGGG + Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1146362894 17:32193237-32193259 ATACCATTTACCCACCTTTCAGG - Exonic
1149056691 17:52375431-52375453 ATTTCATTTTAAAAGCTTTATGG - Intergenic
1152153850 17:78620095-78620117 ATACCACTTTACAACCTCTAGGG + Intergenic
1153204631 18:2684734-2684756 ATTCCATTTTATTTCCTTTTTGG + Intronic
1155188760 18:23411032-23411054 ATTCCATCTTGCCTCCTTTGTGG - Intronic
1156705136 18:39872330-39872352 ATTCCGTTTTACCAACATTTCGG + Intergenic
1157411814 18:47469473-47469495 AGTCCATTTCACCCCCTTAATGG + Intergenic
1158191590 18:54834758-54834780 ATTTCATTTTAAAACGTTTAGGG + Intronic
1158198316 18:54912403-54912425 AGTCAATTTTATCACCTATAGGG + Intronic
1158246715 18:55440162-55440184 ATTCTATCTTACTTCCTTTAAGG + Intronic
1158368220 18:56765362-56765384 ATTCCATTTGATCTCCTTTATGG + Intronic
1159150385 18:64515544-64515566 ATTGCATTATGCCACCTTCAGGG + Intergenic
1159656509 18:71034719-71034741 CTCCCATGTTACCACCTTTGTGG + Intergenic
1159830783 18:73275887-73275909 ATTCCATTTTATCAGATTTAAGG + Intergenic
1163328016 19:16617796-16617818 ATTTCATTTTCTCACCTTGATGG - Intronic
1164246771 19:23437044-23437066 CTTCCAGCTTACCATCTTTAAGG + Intergenic
1164247096 19:23440481-23440503 CTTCCAGCTTACCATCTTTAAGG - Intergenic
1164286081 19:23819002-23819024 ATTCCCTTTAACCACGTTAAAGG - Intronic
926930582 2:18035688-18035710 ATTGACTTTTCCCACCTTTATGG + Intronic
927528525 2:23771693-23771715 ATTCCATTTTATCTCCTTGTTGG + Intronic
928368765 2:30723505-30723527 AGCCCATTTTAGCACCTTGAGGG + Intronic
928927785 2:36596853-36596875 ATTCCTATTTACCATCTTTTGGG + Intronic
928963313 2:36952213-36952235 ATACCATTTTAACATCTTTTCGG + Intronic
929471128 2:42194040-42194062 TTTCCCTTTTACCATTTTTAGGG + Intronic
931060803 2:58527372-58527394 ATTGCATTTTTCCACCTATTAGG + Intergenic
931427747 2:62186403-62186425 ATTTCATTTTCCCACCCTTTGGG + Intergenic
932624614 2:73287341-73287363 ATTACTTTTTCCCACCTTTCTGG + Intergenic
934096203 2:88607794-88607816 TTTCCCTTTTACTACATTTAAGG - Intronic
936393921 2:112103904-112103926 ACTCTATTTTACTACCTTGATGG - Intronic
937535510 2:122881955-122881977 ATTCTATTTTAAAGCCTTTAGGG + Intergenic
939926800 2:148184948-148184970 ATTGTAATTTACCAGCTTTACGG + Intronic
940659172 2:156524970-156524992 ATTCTATTTTTCCTTCTTTATGG + Intronic
942529316 2:176891638-176891660 ATTCAATTTTATTACCTTTGAGG + Intergenic
945507056 2:210654734-210654756 ATGCCATTTTACTTGCTTTAAGG + Intronic
946803013 2:223441539-223441561 ATTCTATTTTAACACTTTTATGG - Intergenic
947772171 2:232679135-232679157 ATTTCCTTTTAATACCTTTATGG - Intronic
948738548 2:240026611-240026633 AATCCATTTAACAAGCTTTAGGG + Intergenic
1169171986 20:3472094-3472116 ATTCCAATTTGCCACCTCCAGGG - Intronic
1169792668 20:9428220-9428242 ATGACATTTTAGCACCCTTAAGG - Intronic
1174340853 20:49894127-49894149 CCAGCATTTTACCACCTTTAGGG + Intergenic
1177347872 21:19897015-19897037 CCTCCATTTGACAACCTTTATGG - Intergenic
1177351559 21:19949359-19949381 ATTCATTTTTTCCAACTTTATGG + Intergenic
1179466610 21:41579996-41580018 ATTTCATTTTACAATCTATAAGG + Intergenic
1182939126 22:34257512-34257534 ACTCCCTTTTACCACTTTTTGGG + Intergenic
1184985172 22:48127380-48127402 ATTCTTTTTTACCATGTTTATGG + Intergenic
949513853 3:4789559-4789581 ATTCCATCATTCCAGCTTTAGGG + Intronic
951299892 3:20983457-20983479 ATGCCATTTTGCAACCTTTAAGG + Intergenic
955733573 3:62013026-62013048 CTTCCTTTTTACCTCTTTTAAGG - Intronic
956513444 3:70019814-70019836 ATTCCATATTAACACATTCAAGG + Intergenic
956543958 3:70378523-70378545 TTTCCATTTTGCTACCTTTCTGG - Intergenic
957717278 3:83944561-83944583 TTTCCTTTATACCACCTTCATGG + Intergenic
959197691 3:103206765-103206787 ATTCCATGTTTCTTCCTTTAGGG + Intergenic
960447951 3:117770766-117770788 ATTACTTTTTGCCACCTTAATGG - Intergenic
960779276 3:121300655-121300677 ATTCCATTTTATCATCTCTTTGG - Intronic
963245871 3:143061884-143061906 ATTCCCTTTTATCACCTAGAAGG + Intergenic
963815664 3:149828196-149828218 ATTCCATTTTCCCTATTTTAGGG - Intronic
964004893 3:151815150-151815172 CTTCCATCTTACCTCCTTAAAGG - Intronic
964411831 3:156406048-156406070 ATTCATTTTTACAACATTTATGG - Intronic
964660784 3:159118012-159118034 ATTACTTTTTACCATTTTTATGG - Intronic
965207998 3:165746492-165746514 GTTCCATTTTACCTCCTAAATGG - Intergenic
966747330 3:183289905-183289927 CTTCCATATTACAAACTTTATGG + Intronic
967645734 3:191920830-191920852 ATTCAATATTCCCACCTTTTAGG - Intergenic
970400337 4:15711278-15711300 ATTACATTTTACAATGTTTAAGG - Intronic
971775128 4:30953546-30953568 ATTTCATTTGAACACCTTCAAGG + Intronic
972062131 4:34888787-34888809 ATGCCATTATTCCACCATTATGG + Intergenic
974499056 4:62674166-62674188 ATTCCATTTTATCCCTGTTAGGG - Intergenic
974546141 4:63309463-63309485 ATTCCTTTATTCCTCCTTTATGG - Intergenic
975221464 4:71817190-71817212 TTTACATTTGACCACCTCTATGG - Intergenic
976513423 4:85936412-85936434 ATTCTATTTTACCACAGTCAAGG - Intronic
976832987 4:89336000-89336022 TTTCCATTTTACCACATGGAAGG + Intergenic
979252704 4:118581910-118581932 ACTACATTATACGACCTTTAAGG - Intergenic
979312232 4:119216828-119216850 ACTCCATTTTGCTATCTTTAAGG - Intronic
979872963 4:125849750-125849772 TTTCTATTTTACCAACTTTGTGG + Intergenic
980537981 4:134154029-134154051 ATCCCAATTTAGCTCCTTTAGGG - Intergenic
983540779 4:168907421-168907443 TTTCCATTTTATCACCTCCATGG + Intronic
985001785 4:185492237-185492259 ATTCCATCTAATCACCTTCAAGG + Intergenic
987581141 5:19794204-19794226 ATAACATTTTACCACCTCTCTGG - Intronic
987793639 5:22600438-22600460 ATTACATTTTAAGATCTTTATGG + Intronic
987899028 5:23986836-23986858 ATTCCTTTTGCCCTCCTTTATGG + Intronic
989015183 5:36922890-36922912 TTTCTTTTCTACCACCTTTAAGG + Intronic
990298077 5:54423403-54423425 ATTCCATTTTCACACCCTTTAGG + Intergenic
990313742 5:54565069-54565091 ATGCCATTTTTTCACCTGTAAGG + Intergenic
990408276 5:55513934-55513956 AGCACATTTTAACACCTTTAAGG + Intronic
990431664 5:55740870-55740892 ATTCCATATTACAACTTTTGTGG + Intronic
991612744 5:68465842-68465864 GTCACTTTTTACCACCTTTATGG + Intergenic
993369575 5:87075458-87075480 CTTCCTTTTGACCACCTGTACGG - Intergenic
994265627 5:97712742-97712764 AATCCATTTTAGAACATTTATGG + Intergenic
994929053 5:106156339-106156361 GTTCCTTTTGACCACCTTTTGGG + Intergenic
997878721 5:137571261-137571283 ACTCCATTTTATCTCATTTAAGG - Intronic
998582839 5:143398801-143398823 ATTCCATTTTCTGACCTTTTTGG + Intronic
999020054 5:148154910-148154932 ATTCTATTTTATGACCTTGAGGG - Intergenic
999069856 5:148732733-148732755 ATTCCCTTATACTACCTTCAAGG - Intergenic
1000198377 5:158983140-158983162 ATACTATTTTACCACCTTCTGGG - Intronic
1006499877 6:34451404-34451426 ATTGCACTTTACCAGCTTTATGG - Intergenic
1007520049 6:42444967-42444989 ATTCCATTTTGCCAAATTCAGGG + Intronic
1007641301 6:43342084-43342106 TTTCCTTTTTGCCACCTTTGTGG - Intronic
1008495544 6:52129709-52129731 ATACCATTTTGCCATCTTAAAGG - Intergenic
1008881177 6:56382072-56382094 GTTCGATTTTACCACCACTAGGG + Intronic
1008949371 6:57138607-57138629 ATTCCTTTTTACCATATTTCTGG - Intronic
1010053338 6:71534330-71534352 ATTCCATTATGCTACCTTGATGG + Intergenic
1010121844 6:72385518-72385540 ATTCCATTATACAACATTTTAGG - Intronic
1010540721 6:77088720-77088742 TTTTGATTTTACTACCTTTATGG - Intergenic
1010770940 6:79830045-79830067 AGGCCATTTTACTACCTTTGGGG + Intergenic
1010774289 6:79867625-79867647 CATTCATTTTACCACCTTTGGGG - Intergenic
1011515106 6:88145112-88145134 ATTCCCTTTAACTTCCTTTAGGG - Exonic
1011797702 6:90975406-90975428 ATTCCATTTTACTATATTTCTGG - Intergenic
1012126874 6:95440557-95440579 GTACCATTTTTCCACATTTATGG - Intergenic
1012691671 6:102320601-102320623 ATTGCATTTTATCTCCTTTTTGG - Intergenic
1012747550 6:103113154-103113176 TTTTCATTTTACCAACTTTCCGG + Intergenic
1014296309 6:119621868-119621890 AATCCATTTGATTACCTTTAAGG - Intergenic
1014498660 6:122158911-122158933 GTTCTATTTTCCCACCTTTCTGG - Intergenic
1014593656 6:123305457-123305479 TTCTCATTTTACCACTTTTATGG - Intronic
1015397515 6:132751808-132751830 ATTCCCTTTCCCCACCTTTCAGG - Intronic
1015600619 6:134906709-134906731 AATCCATTTTTTCACCTTTTTGG + Intergenic
1015768811 6:136747869-136747891 ATTCCTTTTTACCCTGTTTATGG - Intronic
1016088069 6:139940555-139940577 ATTGCATTTTATCACCCTTTTGG + Intergenic
1018107074 6:160498970-160498992 ATTCAATTTTACCGCATTTGTGG + Intergenic
1020642509 7:10773536-10773558 ATTACATTTTCACACCATTAGGG - Intergenic
1020725335 7:11806408-11806430 TTTCCTTTTTACCATCTTTTTGG - Intronic
1022299397 7:29089079-29089101 ATTCCATTTGGCCACCTTGCTGG + Intronic
1023036971 7:36139927-36139949 ATTCCATTTTATCTCCTTTGTGG - Intergenic
1025771235 7:64509434-64509456 ATTCAATTTTTACACTTTTAAGG + Intergenic
1025875460 7:65476839-65476861 ATTCGATTTTAACACCCTCAGGG + Intergenic
1028289886 7:89052005-89052027 CTTTCATTTTACCAACTTAAAGG + Intronic
1028622916 7:92844483-92844505 ATTCCATGTTATCTCCTTTGAGG + Intergenic
1031048062 7:116915752-116915774 ATTCCAATAGACAACCTTTATGG - Intronic
1031321794 7:120339366-120339388 GTTGGATTATACCACCTTTAAGG + Intronic
1031382158 7:121100159-121100181 CTGCCATTTTCCCACCTTTATGG + Intronic
1031844750 7:126791733-126791755 AATCCAGTTAACCACCTCTATGG - Intronic
1032028059 7:128459197-128459219 TTTCCAGTTTCCCACCTTTCGGG + Intergenic
1034224330 7:149471114-149471136 CTTCCCTTTTCCAACCTTTAAGG - Intergenic
1037932422 8:22889555-22889577 ATTACCTTTTACCTCCTTTAAGG - Intronic
1039638126 8:39188338-39188360 ATTCCATTTATCCATCTATATGG - Intronic
1042424326 8:68629325-68629347 TCTCCATCTTACCACTTTTAGGG - Intronic
1042954391 8:74233551-74233573 ATTGCATTTTAGCACCTTTGGGG + Intergenic
1044056426 8:87575871-87575893 ATTCTATTATAGCTCCTTTATGG + Intronic
1044295736 8:90525162-90525184 CTTCTATTTTCCCATCTTTAAGG + Intergenic
1044897474 8:96907749-96907771 ATTCCATTTTCTCAATTTTAGGG + Intronic
1045139037 8:99258725-99258747 ATTCCATTTTGTCATATTTATGG + Intronic
1045151209 8:99410458-99410480 ACTCCATGTTACCTCCTTTGTGG + Intronic
1045992708 8:108328267-108328289 CTACCATTTTACTAGCTTTATGG - Intronic
1046313137 8:112464960-112464982 ATTTAATTTTACTACCTTTTTGG - Intronic
1049384590 8:142335551-142335573 ATTCCATTTTATCTCCACTAAGG - Intronic
1050096423 9:2072220-2072242 ATTCAATTTTATCACTTTTCAGG + Intronic
1052113088 9:24614127-24614149 ACTTCACTTTACTACCTTTAGGG + Intergenic
1055122025 9:72671517-72671539 ATTCCATTTTACCACCTTTATGG - Intronic
1059623840 9:116039658-116039680 ATTCCCTTTCACTATCTTTACGG - Intergenic
1187356061 X:18573106-18573128 ACTTCATTTTTCCACCTTAATGG - Intronic
1188042087 X:25380201-25380223 AAACCTTTCTACCACCTTTAAGG + Intergenic
1188183833 X:27089202-27089224 ATGCAATTTTACCAACTTTTTGG - Intergenic
1189742776 X:44137804-44137826 ATTTCATATTCCCACCTTAAAGG - Intergenic
1190243342 X:48674931-48674953 ATACCATATTACAACCATTAGGG + Intergenic
1190682771 X:52842393-52842415 AAACCATTTTACAGCCTTTATGG - Intergenic
1191174546 X:57485113-57485135 TTTCCATTTTTCCAACTTTGGGG - Intronic
1192897279 X:75457428-75457450 TTTCCCTTTTACTTCCTTTATGG + Intronic
1194775338 X:97956146-97956168 ATTCTAATTAAACACCTTTAGGG + Intergenic
1194824740 X:98547856-98547878 ATTTCATTTTTACAGCTTTAGGG + Intergenic
1195585364 X:106559160-106559182 TTTTAATTTTACCCCCTTTATGG + Intergenic
1195757717 X:108215769-108215791 ATTCCATTTTTTCCCCTTTCGGG + Intronic
1195800525 X:108703918-108703940 ATTCCCTTTTATCTCCTTTGTGG + Intergenic
1199583765 X:149389503-149389525 ATTCTATTTTATCTCCTTTGTGG - Intergenic
1200643506 Y:5752203-5752225 ATTCCATTTATCCACATTTTTGG - Intergenic
1200694307 Y:6344848-6344870 CTCCCATTTTATCACCTTAATGG - Intergenic
1201040970 Y:9829868-9829890 CTCCCATTTTATCACCTTAATGG + Intergenic
1201761063 Y:17539052-17539074 ATTCTGTTTTACCATATTTAGGG + Intergenic
1201840489 Y:18366938-18366960 ATTCTGTTTTACCATATTTAGGG - Intergenic