ID: 1055122025 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:72671517-72671539 |
| Sequence | ATTCCATTTTACCACCTTTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055122025_1055122028 | 18 | Left | 1055122025 | 9:72671517-72671539 | CCATAAAGGTGGTAAAATGGAAT | No data | ||
| Right | 1055122028 | 9:72671558-72671580 | ATCCAAAAGAAGGCTGAAAGAGG | No data | ||||
| 1055122025_1055122027 | 8 | Left | 1055122025 | 9:72671517-72671539 | CCATAAAGGTGGTAAAATGGAAT | No data | ||
| Right | 1055122027 | 9:72671548-72671570 | AAGTCAATTCATCCAAAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055122025 | Original CRISPR | ATTCCATTTTACCACCTTTA TGG (reversed) | Intronic | ||