ID: 1055122027

View in Genome Browser
Species Human (GRCh38)
Location 9:72671548-72671570
Sequence AAGTCAATTCATCCAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055122025_1055122027 8 Left 1055122025 9:72671517-72671539 CCATAAAGGTGGTAAAATGGAAT No data
Right 1055122027 9:72671548-72671570 AAGTCAATTCATCCAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055122027 Original CRISPR AAGTCAATTCATCCAAAAGA AGG Intronic